Description :
From Genome Similarity Track
Location :
Scaffold_1003:3152- 5124
Transcript NameFunction/comments
g15233.t1hypothetical protein

Sequence
1972 bases(100 bases per row)
ACAGTCACGCAGTGACTTGTGTCCGTGGTGGACACTGCGAGGTGTTTCCTTGCACAAAGAACGTCCTTAGCAGCCTGTGTTGCAGCGCTAGCAAGGGCAC
AGTACTTTGGCACGGGGTGCTACTGCATCCAAACTTGCGTTGGTTCTCGTTGACCACCTGCCGTTCACTTGGGAGGAGCCGTGGGCCCTCCCTAACACTT
CGTGTGTCTTGGATCTCCCGTGTGGGTCGACACCATCCCGGGCAGCACATAGCCCAGGGGTGGAGAGAGCTCGCAGCTCACCTCCTGCCATGATAGCGGA
CCCGCATGGGCCACGCTAGTCATGGCTAAGCGCGTGAAGCATCGGTGCCGTACACGCGTTCAGGTCATTCGTTGACCAAAGCACTAAGCATCGTGCTTTG
TCGTAGTGATATGATGGCTGCCATTAGCAGCCTGGTCATCACTAAGAGCATTTCGGGTAGAGCAGCAAGCTCCACCCCGCGTCTAGGTCGTCGTACCATA
TGTCGATGCCCGACACCGACGTACCCATCGGTACTTGAAGCATAGTGGAGAGTTACATGCACTCTCTACCACCTTCACTCTGGTGCCGGCGATTGCGTCG
TGCATCGCCAAGACCAGGGCTCGGTCGGAGTGCGTGCAAGCCTGCACGACACTCGGTCTTTTAATGATCACGACGACGTACGGGCCTGTGAGCCCATACG
TCAGTGGTTCCCCGTGTGCTACGGCTACCACTAGAACATTGAGATGTTCCGAGTGCGTGCAAGCATGCACGGCACTCATCACCACATGTGACCGCGTCGG
CGTACGGGGCTGTGCTTCCGTACGCCAGAGGTACGCTGCGTGCTCAATGCACCACGGCTGCCTCAAGTGCCGCAAGCGTGCAGCACTGTTTTGGCTCATG
CCAACAGCAGCTTCCGTGAGGAAGCTAGTCTCCCTAGATACTTGGGAGGAGAGGTATTTCCCCCCCCTCTTACGATCGATCCCCCTCTGGGATGATCGGG
TCGAACGCGGCTCGAATTCTTCCAGCCCGGGAACAGTTTGAGTCTGTTCCTCTTCAGTTAAGGTCTGGGCGACCGGCCGCGATATACATTGCGCCAGGTA
CGACGTCAACCATGTGACTCGTGCCATGAAGTGAAACACTGGGTTCTTTGGAACCCGAGGGCAGCTTGCGCTTCGGCATGCAAGGTTCAGCAATGCTGAC
ATGGTGGCAGCTGATAACCGGCTGCACCATCGAGCCGACCGTGTCTGAGGAGCATAGCTCCGAGTCGTTCATTGCGACTCCGGTCTGGTACGTGCCCAGA
CCCGACTTTCGGCGGCGACGGTGTCGTCAGCGGTCATCAGGACGTGGAACTAAGTTACCCACGTCTTGGTGGCGGTGCCAGGAGTCTTATCGACTCCGTG
TGGAACTTGGTTACCCACACAGGAGGTGGTTATAGCAACCTCCAGCTGGCCACGATCTCGGCCGTGGACTTAAACCACCGGTCCGGTAGTGCCACTCGGC
ACTACTGAAATCGAAGCCCGTACGGCGCGACGACTTCTCGGCGATGGTCGCTGTGATATAGCGCAGCCACACATGCCGGGCAAGACGCCCTGTCCATCGG
CTAAGCCTTTGACGGTCCGCGAGGGTGGACATGATCTTGCGACCTGTTACGCAGTTATGCGTAATTACGTCAACAGAACTCTTCCAGGACGTTACTGTCC
AGAACAGAAGAAGAGTTCGACTCTTCAGGAGAGGTCTCTGGTTACAGGAGTACTATCTCCCCAGCCTTCATGCTGGCCTGGAAGTCGTGCAGCGACATTC
CCTCGAGGTTGAAAAACTCTGACACCTCCGGCTGGGCGGTCAAACGTATGACCCCCGCCTTGACCTGACAGGTCTCGCCGTCGAAGATGTGATAGCATCT
TCGGCCGGCCGTGCCTGAGGAGCGTTGATTACTCCGAGTCGCTCGTGGCGACTCCAGTCTGTTTCAACAGAC