Description :
From Genome Similarity Track
Location :
scaffold_1268:3152- 4974
Transcript NameFunction/comments
Pl_100951Amino Acid/Auxin Permease (AAAP) Family
Pl_100952hypothetical protein PHYSODRAFT_515521

Sequence
1822 bases(100 bases per row)
TAGGCAGCCGTACTGTATGAGTGGGTTACTACGTAAATATTGCCATGACAGATACTTTACGTACTGGGTACTACCCTGTGATAGTGTTGCTTCAAACAGC
TTGCTTGCGTCTGTGACTTAATGGGAATTCATGCTACCGGTTCTGTAAAACAGTGATTCCGCGACAAAAGTGACAGAACTCCACAATCCGGACGATAGGA
TGTCCGACATCCCATCGACATTATATCGTGCTGGAATCGCATTAGACTTCAACAACCTGAGTTCAATGCGATTCCACGAGTAGTATATGCTTGAACCGTG
GAGCATGATGCTTAAAACTTGAACAGACTACATAATATGAAAATATATTATGTGTGATCAAATGAGATACTGCTTTGGCTTAATCGTACGACTGAGTCCA
AGTTTTGTTACGCACCGGCATACATGTAATGAAGTGTGTTGCATCAAGGACTTCCTTGCTACACACATATGCACGCATCGCTAATACCGGTGTCAATACT
ACTACTTACGATTAGTGCTGTCTACGTCAGGTGTTATTGCCGTTAACATCTGTGACGTCAAAAGTTGCTATCGACGTGAAAAAGCAGACTTCAAGATCTC
TTGGGAAGGGTAGGGTTCGCATTGCTCCGTATCTCCATTCGGCGACAACTTTCACGGATCTAATGGACGCCCCGCACCATTTTGCTATGTGGACAATCGA
CTGGCCCAACACCTTCGGATCGATTGATGTGGAAGCAGCGACTTGGTGAGTAGCTCCTTCGTCACCGGGTTAACGCCTGCATTTCATGGCGCGCTGATCC
GTTGCGCGATCACTTTCTCTGGTCTTCGTCTTGGACTGTGAGCGTAGAACCGGTCGCGCTGTGCTCTGCAGGTGTAGTGTGACAACGGCAACGACGGGTG
TAGACGGACGAAGGCTGCGTGGTCTTTCAACTGTACATTTGCGCAAACACAGGAAAATGCTGCTGGCTGTTTCGCCCGCTCTCCAGTCAAAGCACCGGCT
TGTCGGTCCTCGTCAAGCCTCATTGTTCATTTTTCCGTCTGTCCGCAATGGCAACTTCTTCATCTTCGGCCGCGCGCTCCGCCCTCTTCACGCTCGAGGA
TGCTAAGATTGCGTTCAACATCTTCTGCTGCATCTGCGGTATCGGCTCACTCGGTATGCCGTCCAACTACGCCCGCGCCGGCTGGGGATACGCAACCATT
GCCCTCCTGTTCATGGCGTTTTCAAACATCTACGCCACAGTGCTGCTGTCCAAGGTGTTGATGGTTGCCCCAGCTTCAGTGAAGACATACGGTGACCTCG
GAGAGTGGGTCGCTGGCAAATGGGGGCGCTTCTTCGTCGTGGTCTCCCACATGGGCGTATGCTTGCTCGCCCCGTGCGCATTCCTCGTTCTCGGCGGTAC
GTTACTTGATGTGCTGTTCCCCGACTCGTTCAGCCAGACCGTATGGATCATCTTCATGGCCTTGCTCGTCATCCCGGTGGCGCTGATCCCAACGCTGAAG
GAGAGTGCAAGCATGGCTGTGGCGGGATGTTTGAGCACAATCATCGCTGATGTCATCGGTGTTTCGATCCTCCTGTACGAGGAGCGCGGTCATCCGACGC
CACCCACTCCAGATGTGACACTTCATCAAGTACTGACCACGTTTGGCAACCTGTCACTGGCATACGCTGCCGCTATCGTGATCCCTGACCTCCAGCGCCA
ACACTCGCAACCTGAGAGAATGCCCCGTGTCATCATCGTCAGTCTTGGCCTTGCCTCGGCTTTCTTCCTCGCCATCGCCATAATTGGCTACGTTGCCGGT
GGATGCCAGCTCTCGGGCAACC