Description :
From Genome Similarity Track
Location :
Scaffold_614:3152- 4585
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_614-snap-gene-0.9Liver stage antigen
Pytiw_DAOMBR242034maker-piw_contig_614-fgenesh-gene-0.5Putative coiled-coil domain containing 104 variant 1

Sequence
1433 bases(100 bases per row)
TGCAGTCCATCTTTCGTGGCTTCTCAATTCGGCGCAAGTTTGCAAACGCGCTCGAGATGGCGCAGTTCATCGGTGTCGATGAACTCGAGTTTGGGGAAGT
GAACCTGGACGATCTCATCCAGAGGCCACCAGAACTTGACGACGGCTGGGAGAACCCAGTGCTTCCAGTCTCGAGGCATCACCATCACCAGCATCAGAGT
TCGGCTTCAGCTGACCGCTTGGACGAAGGAGGAGGGCCGGAGAATGACGACTATGGAGACCCAGAGCAGCTTGAGCGAGTTGAGGATTCCGACCGTCGAT
ACCCGTCAGGGTATGGAAGTTATGGTGCCGTGACAGCCTCAGTCTTGAACCGAGTTGTTGCTGGTGATGGTAATGGTAGTGGCTCTCATCGCACTGACCA
TGTCACCGAGTCACAACAGCCTTCACTTCAAGACACAACACCAGTGACGCCAGCGAACTTGGCGTCGACTCTGTGGGACAAAATGCGCAAGATGAAGCAG
AAGCAGCGCCACGCGGCGGAAGAGCGGTCGCGAGAGCAGGATCCGACGTACCGCCTGCAGAAATTAATGGGCAAGGGCAACAAGAAACAGCAGCAGGCAC
CTACCAAACCCATGAGCAACAGCAGTGGCAACCAAGGCTGTGCCCCCAGTACCGCTTCGAACGCACCGATGATCTCCTGGGGCTCGTCGAACGGGAACGG
TGAGAAAAAGAAGCCGAAGGTCAAGCTTCCGTCGCTGGTCGAGCGACTTCGCAAGAAAACGGAAGCTGCGCGGTGATAAGGCAGGTGAAAAACATTCCGA
GTCGAATTATGCTCACGATGCTCCTGAGCTTTCAGCGCTTTGCTAGCAGGAGTGACTCCTTCGTCTGCTTCATCATCATCACAAACACGTCAAAGTCTGC
CGTGGCCACCAGGATCTCCGAGCACAGCACGATGCTCGACTGTCGGTCGTTCTTGTACGCGTGGCGCACCAGGCGGTAAAACTCCTTCACCGTCGAGCCC
TGCGAGACGATGTAATCTGTTGCCCAAGCAAGCGAAAGACACCAGAGCATGTGAGCGACTCTACCTGCACCCAACTGGGATCGAGAAAGGCCCAATGGCT
CTCGTACCTTCCAGCTTGGCTTCAAAGAGCTCGAGGAACTGGTTGTAGATGTCCGTGTACTCGAGCTTCATCTCTTCCGTGTCGAGGTCGAATGCGTGAC
AGTGCGTCTCGGCGAAGCGCTCGAACGTCTGCGCGAACTCGTCGTCGTCGAAGAAGAACGCGATCACCTTGCTCACGATGTCGGCTCCGTCGCCGCTGCT
TTCATCCGCATCTTTGCTGTCTTTCGCCTCGGCTGCTGCGGATGATGCTTTCTTCAGTGCTTCCTTTGCCTCGCTGCTGCCAGTGGGTTTCTTTTCGTCG
AAGTCAGCGTCACTGCTGCTCTTGCTCTCGCTG