Description :
From Genome Similarity Track
Location :
contig_42:31514- 33267
Transcript NameFunction/comments
g9455.t1OWZ18522.1 hypothetical protein PHMEG_0007369 [Phytophthora megakarya
g9456.t1ETK87740.1 hypothetical protein, variant [Phytophthora parasitica

Sequence
1753 bases(100 bases per row)
GTTCTCAACCACGCGACGCCGGCAGCACTGCCGTCTCTGTGGCGAGGTGGCCTGTCGTCGGTGCATGATAATTCGTGATGCACCATTGCTGAATGATAAC
GCTACTGTGGCGCCACGGACATTCCAAGTTGTCAAGACGATGTTCTGCAAGGCTTGCATGGGGAAGGTTCGAGGCAGCGAAGTCAAGTCTATCACCAGCG
GCGACAGCCAGGACGAAGGCGTATCGGACGCCGAGTCCATGAGCTGGTTCCCGGACAAGTCGCGCACTCGAAGCTTTGACAACGATACCAACTTCACAAT
GACTGGCGGCTCGTCAATCGCATCTCTCTCGCCTACAGGTGGCAGTTCTGCTCGCTCCGCCCCACCGCAAGATGGCATTGACGAGGATGGCGGCGATGAG
GAAAGCAAAAGCCTTCAGAAGTTTTCGAGCAGCATCAGCTCGGAGGTGCAGTCTGAAACGAAGACCAGCGTGTCGTCTTCACTAGACGATGAGGTTGAAG
TGGAGGTGGAGGAGGTCTCGGAGCCCGTTGTTCCCATGATGATTGACCTGCGTCACCTGCGAACCATGGCTGGAGCGGAGCGTGTGGTTCAAGAGGTCGA
GGAGGAGGAACTTCGTACAATGCGCGAGTCCCTCGCGGCGCTGGACTTCCAGACCGTTCGCCTTGTATCTCCGGTGACTGCAGACGGTGACTCACAAGAA
GGGTTTTCCAGCGGCCAACTACCCATTATGGAGGAAGACGACGTGATCGAGGTGGAGGACGAGCCCCACCAGATCGTTTCTGCCACCCGACAGATCGTGT
CGTCTCCTCTCGATGATACGCCGCTGAACGGGGGGATACTAGCGGAGCAGCCCCTGTTCGGGTCCTCTCGATCGATCGGTCAGTGTCTTCAGGAGCAGGA
AGTGCTGTTAAAGCGCCTCGTAATGGCGGCGAACTCATCAGCCGGGTACTGCCCACCCAACGCCCGCGGATAATCGAACCACAAGGAATCAACAACAACT
AACGATGGCTTCCCGTGTAGGGTAGCCACGTACATCACGTAGTGTTAGGACTATCGAGTGTATTACCATTTACTGAATCAATGTTTCAGTGGTCTAGTTG
CTCGTAAGAAGAGATTGCACCAACACTTTAACATTTTCTTGCATCGTCATGGCAAAGAGTGCAAAACCTTCCAGCGGCTTGAGGTCAAGTCAGCAGCAAG
AAACGCCATTGCACTTCTACAATCGGCGGCAAATGCTCCGGTGTTGTAAGTTCCGCCCCGGCGATCACAAAATGACTGGAAGCGTCGAGACAGGACACCG
GTGAAGCTTTTGCTCTGGTCGCGGTGCAACCCGAACTTGCTGCGACCGCCTTACCATCGGCCCCGGTGAACACCATGCGGGTACGAGGATTAAGAAAAAA
CCTTTTACTACGGCGAACGCCACTTCAAGACAAGTACATGCACGCTCGTCCGTGCAATCGGAATCTATAGTTGATGAACGACGGGCGAACTTCGTGCGTG
CGTTGCGACTATCCAAGGCAGCTGCACTTGCTCCGTCGCGACAACAATGCAATAAAGGTTGAGATCTTAAAGCGCTGCAGGCTTATGGCTGTCCTGGGCG
GCCAGCATCAATCGCCTCAACAGGTTTTCTTGCTCGGCGATGCACTGGTCAATGGTGCGCCTTGATTCTATCTTGCCGGAGCTGTCGGGCTGCTGGTGCG
CGGATTTGTCGTCGAAGGAGGCTCCAGCGTTGATCCGGCGCATCATTTGAGAC