Description :
From Genome Similarity Track
Location :
Scaffold_1610:3151- 6705
Transcript NameFunction/comments
Phyag_g11093hypothetical protein

Sequence
3554 bases(100 bases per row)
TACATGACAAGCGAGCTGGCTGCGCTGCAAACGGCGCAGCGCTCAACCAACTAAAACATAGCCTCGCGTTATTTCAAATGACCAAATATTAAAACTAAAA
AAACGTAAAATTACTGCCTACTCAACTATACCACGATACACAACATTCAATAGACAGTATCCGCTCTCCTCTCGGTGAGCATTATAGTCCACCGCAATCT
TGACATGCTGCCTTGATGTTGATCGTGAAAGCGCGACGTATAACTAGCCATGAGCAAACACTGGTTGCGGTAAGCACACACTAAGTTATCGTAGTGCCTG
TCCTTGAGCCTTGTTAATAGTAATAGCAGACGCCCACTGAACCGGAAACTGGCGCCGGCGAAGCTCAAATGGAAGCCCGGAGTTGTGTGAGATCAATGGG
ATGTGTGGGATAACGACAATTTTGCTGGTGAGGATTCCGGTCAGCGCTTTGGCCTCGATGTAGTGGTTATGCATATGGAGCACTTGAAGGCGCGTTCCGT
TGCATAGACCGCTTTCGCCCCTGATGTTTCGGAGTAGTATAATCGGAGCACCAACCTTGAGACAAAGCTTGTGTGGTGGCATTCCGGAGATACTTAGCGA
ATTCAGAAATTCCTCAGGGAACATTGACGTGTCCGACCCTTGCGCGTCTTCAACCGTATCGATAGAGACGTATCCCTTGGCCTCTCCTGGCAATGTTTCT
ATCGCTGAATTATTGAGCTTTAACACATCGGCATTCAGCGGCGTCAGAATTGCTCTGGCTGCGAAATAGTCATCTTCAAGATATCTCTCCCCGAGGTCAT
CGTATACGTGATCGATAAGGGCCTTCGCCTTTTCCACGCCATCTGGAGTCGTCAATACTATGTCTTGTTGAATCCTCGTGTAGTCTCTACCTCTCTCGGA
GCACCGTTCATTACGtccttcaccaacacgcaGTAGAAAGTCTGCAAACGTTCGGGTCTTCATTGCGGTTGTTCCATCCACCATGCTCTGAACTCTCATG
CTCGTCTTGAGATGGAGTATGTCAAAGTTTGCCCATAGCGACGATCGCTTGATACAGCTGTTGACTACTTGGCCGGGCGATCCATGGGGAATCACAGGAA
GGATTTGACGGAAGTCGcctgccagcaccaccacttTTCCACCGAAGGGTTTGTCGTTCTTCATGGGATCCCGCAATGTGACATCCACCGCCTGAAAACC
GTACTTGATCATCAACGGAGCCTCATCCCACACAATCAATGAGTTTGCCTGAGCAGTTCCGCACGGTCGGAGCCAGCCGTCACATTACAGGTAGACGTAG
AGGTGAGGTCCAACCCGAGTTGGAACGTATAGTGTGCCGTTCTACCTCCCATTAATTGTGTCGCAGCAATTCCGCTTGAAGCAGCTGCCAACGCGATCTT
TCCGTCCAAGCGAACCGTCGCTAGAATTGTCTGCAGTAGGAACCACTTTCCGGTACCGCCGGGGCCATCCAAAAAGAATAGCTTCTCGTCAACATTACCA
CAGTGGATAGCACCGATCACCTTGTCATACACCACCCTTTTGTCGTCATTTAAATGCCCTGCTTGAGATTTCAGGTCTTCCATTGCTGAGCGATCGTAAG
AACTCTCCGTCTCGATCAACCGATTTGACGCCGAGTCATTGGGGTGGAGATCACCGAAGTCCGACAGCTTGGGTAGCCCGTGGAAGTCTTCAATTTGTTT
GTCATTGCTCCGCAAGCACTGGTCAACAGCTCGAACGGTAAGGTAGATCACCTTTTGACTCGTTACCGGTTGTTGACGATCTAACTGGAAATCCTCAGAC
ATGTCATTCAGGAACGTGTCCCACAGAGTCTTGGGAGAACTGGGATGGCAATGCACCAAAATAATGGCGAACAGGTGCCGAATCTAGCTTGACGTCTGGT
GTTGGCTTGCTTCTTCCATGCATCGACGCCAttcatcgtcgctctccaaGAGTCCCCTTGCttgggcagcagcttgaaacGTCTCATGAACGATTGCATC
CACCGTTCGAAGGTCCTCAAACGATGTTGGCCCTCGTACGTTGCACACCAGCGTTCGAACAAAAAAAGCGCTCTGTATCGTTGTGCGAAACAGAGACCAT
CCGGCCAATCGCCTTTTCACTGCCTTTCGTCCTGGGCTTCCAGTTCTTGCTTCCTTTAACCTAGGTGTAGTGACGTGGGAACTCGTAGTAAAGTAGCTCT
GTAGCATTGGTATCCGCAGCACACATTTCGAAGAACCTTGTCAGCATTGTATGTCGTTGGTTGGGAATTCTTTCCGGGTGTTCAGGATCAAATATAGTAT
AGTTCATTTCCGGTAGATGAACTGTCAACTGGATCACCGCATGCAATTTTCACTGCATTGGATACTTCAACATACGCCAACACGCCTCAGGAGGACAGAT
ATCGCCCACTGAGATactcctccacttcgtcgaTATCAACACGTCGAGTGGTGTTGTTGCCCACGTCAGTGACGGGCGCCTCCATAGAAAACGTAGCCCG
ATCTTGTCCCTTGTAGATGtacttgtacatgtacttgatcGCGTTGATTGTCGAGCAGATCTCAACGTTGATGTGGCAGTTATATTTCTTGCACAGGTAT
GGATTATACGGAACCACCCAGCGGTTGTCCAGCTCGACGTTCTTGCGCATGGTTGATCGGCCTTGGTCTCTCCGTCTATACTCTGGGTAGCCACTTTCCT
CACGCGTCGTGTCCGTGTGGAAATGTTTGGGTAGCCATTTGAACAGACACCATCCTTCACACACGGAGCTTTAGGATTGAACACGCAACATGGTCCATGT
ATCATGCACTTGGTCGCTGTCTCGTACAATTGTGGATGTGTGTTGGGATCTGGGAGTTCAGCGCACACAAACTTGTCGTAGTCCTCGGGACGTCTTGGGC
TCGAGTCTTCCGTAAGTTTCACCAACATGTGAGCATGTGGTAAGCTTCGTTTCTGGAACTCGATAACGTAGATCAGTGCCTGGACTTTCCCAAAGACTTC
GTTCCTAATGATATCATCCTTCATGGCCTCCAATTTCAGCTTGAACGCTCGAGCAACCAAATCTGGGCGGTCAGCACTGCGTTGGCTCTGGAACAGCGCC
TCCTTGATTTCTGGTCACTCTGGATTACATGTGATGGTGATGAATAGATCTGGCTTGCCAATTTCACGTACGATCGCCATGGAGTCATAGTATTGCTTCC
GCATGTATCGCTCACCACCTATAAAACTTGGAGGTAGAAGAACAAATCGCCCGACTTCTTCCAAATCGCCATCATGGAGAACTGCGTCGATCACTCCACG
GTAAAGATCTGCACGTAACGTGCCTTGGTGTAGTTTGACGTAGCGAAGACGTTGGAGCTCAATCTTAACATACATTTCAACGCACCACTGCTGGAAAAGC
CGAGAGGACCGATGAAGAATGGAGAACTGACCCGTACGCGTGAAGAGCTGGTAGACGTAGAAATCACGCACCTTCATACGTTTGTTCTTGTAACGCAATA
TACCTGGCTTGTATTCCACTTTCGTTGACCATCCTTGTTCTCCATACGGAAATA