Description :
From Genome Similarity Track
Location :
contig_50:31504- 34551
Transcript NameFunction/comments
g9891.t1hypothetical protein

Sequence
3047 bases(100 bases per row)
CTCAAAAGATCTCGCTCAGCGTAACTGGCTAGCAAGCCATCGATCATAGTCGTTTTCTTGTCGGGATACCGCTGGTTGAAGTCACTCAGATACTTGGCCC
AGGTTTCGAAACGTGGATCGGTAAAAACCTTTGCGTCTGCCGTGGGCTGTCGTAGAATCCAGTTGAAAGTAGCACTTGGAGGCTTCTCCATGACAAGCCA
ACGTTTCAGCTGTCCTGCCTGCACCTTTTCAGCAATTTTCAGAGTGCTTGGATTTTGCAACCCCTTGTTAGCCATCGATTCAACACCTCCATCACCGTAG
GCCGCATGAAGTGAAACGTACCAATCGGTTTTTGCTGGATTCCCCTGGTCGAACGTTTTCACGTAGGTGAGCCACGTCTTGAACAGTGGATTGCCAATAA
CATTGTCCCATGCATCGCCGAGTCCAAGTAGCTTGAAGACTTCATCGGGAGATTTGTTGCTGGCGAGATAGCTCTGGATCTGATAAGTATATAGTATTGT
CCTTTCGGAATACTGCGAATTTTAGTGTAGTTGATGTATTAGTTGTTTTAGTACGGAAGCCTTAAATGACTAAACGCTGCCCAGCGTAGTACAAGTATAG
TAATCTTTGTCTTCGCGAACGCCTTTTACATATAAAGAACGCAAGTATATCTGGTATAAAATCCAACCGATGGTCTGTCCCTTCCAAATGAAACAAGAGT
TTTGAAAGTTTTTTAGGCTTGGGTCATTTGTTGAGGAAGTAGATCACTGTAACAAGCGGATAGTTGCCAGCACCGGTACCCTCGACCACATTAATATCTT
GGAATCTGTAACTGTCCCATAATCAATTGTCCCCAATGAAGACACTTCATGGCATTTCACCGTCGTTGTCCGTACTTGAATCCTGGTAGACAGATGGAGA
TGAACTTTTAGGATCGACCAGTAGCAAACAACGGAAATTGTCCCTGATCACTCGTTCACCCCATCCGCGATACCGTGCGCGCCAAATCGATAGGACCCCG
AATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTCTACTGCGAATTAGAGACTGCTATTTAGATATGTTGCTGCTTTCATGCATACCAAGAGCAGGCTT
GCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGGCTGGTATACAGATTGCAGGTTTTGACAAGAGCGACAAAATATAGTACCATATCCTTTTCTGGCG
AAACCTACACGTTTTATGCGACTTCATACAAACTTCTATATTAAAAGAATGAATGTCACTACTGGTCAGATGAATGGAGGAAACTTGTTGTTGAGCAGCT
CACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATTTTTCAATGGGCCGTGGTAAAGCCCTCACCAACCAAGAGTATTGGTGGATCATCGGGCTCCACGA
CGGCGGGGTCTCGCTACACGACATCTCAAGAAAAACCGGCCGCTCTCGCACCTGTGTGCGGAGGGCTATCAAGACCGAGCGAGGACCGCAGACCTACAGC
GGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCACTAACTGAGAGGGAAGTGCGTGTGCTGGTTCGCACGGCGGCGTCCGGAGAACACTTCGCAGCGG
AGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGCCAACGATACAGAGGATGCTTCAGCGTGTGGACCATCTTGTGGCGAGGTCGATGAAACCTTTACC
GCCCAGGGGGGTTCGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGAATTGAAGGGGGAAGACTTGTAGGAGTCAACAAGTATCCAAGATTCCACCGCGA
AGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCGGCTCGTTTGTCTTTGACGAAATGGCACTTCACCGAGCTTGTGGCCTTGA
AGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCTCAACGACAGAATGGCAGAGTGTAGTCTGGATTTCACACCCAGAGTATCGGAAATTCAGGATG
CACCTTTACCCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATACAATACAAATAGCCGTCACTTATTCTTTTCGACCCTTGGACGG
TGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTATAAACGCGCACCACTCTCAATTAGAGAGAAACTAT
CAAATACTATAGTCAGTCGATACACACAGCAAAACTATCACTTCGGGGACAACTGCTAGTCAGTCACCTCGAATAGCAAGGGAATATGAAATGGGCAAAC
ACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTTTGGTCACCACCTAACTGGACTTGATGATATGAG
GTGGAGATGCTACAGACGACCCGTCCTTAATGGTCGCAGTGCCCCTTTTTGTATCGCGGTCGTAGTCTCGGGTCCTCCGGATTTCCGTCGGCAGGCTTGG
CCGAATTCACTTGCGCAGTACGGGTAAAAACAAACTCTGTTGTTGGCTGTAAGCCTTAAACTATCAATTCTTTCTAGATCTCGGCTCTGGGTGATTTATC
TTGATTTCACTATGTCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAGCTTCAAAAGTGTCGACTCGACAGTTCTGTTGG
GTTCTTTGGCGGTAGTTCAATGGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGTCAGTGGTCAACCATCAAGATTCTGGTATTCTGGA
GTCAGGATTTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCCAGCGCACGACTTGGGTGTTGGTAGTGGATGATCT
TGGTTCAGTATCTTTAGTAGTCGCTCTGAACCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAACTGCACTTTCCGCCAGGCTTTAGGCACTCAT
CGTAAGGGAAAGTCCGGGGGCTGGACATAATGCGGGTTTGCAATCGT