Description :
From Genome Similarity Track
Location :
contig_50:31503- 34549
Sequence
3046 bases(100 bases per row)
CGGGATACCGCTGGTTGAAGTCACTCAGATACTTGGCCCAGGTTTCGAAACGTGGATCGGTAAAAACCTTTGCGTCTGCCGTGGGCTGTCGTAGAATCCA
GTTGAAAGTAGCACTTGGAGGCTTCTCCATGACAAGCCAACGTTTCAGCTGTCCTGCCTGCACCTTTTCAGCAATTTTCAGAGTGCTTGGATTTTGCAAC
CCTTGTTAGCCATCGATTCAACACCTCCATCACCGTAGGCCGCATGAAGTGAAACGTACCAATCGGTTTTTGCTGGATTCCCTGGTCGAACGTTTTCACG
TAGGTGAGCCACGTCTTGAACAGTGGATTGCCAATAACATTGTCCCATGCATCGCCGAGTCCAAGTAGCTTGAAACTTCATCGGGAGATTTGTTGCTGGC
GAGATAGCTCTGGATCTGATAAGTATATAGTATTGTCCTTTCGGAATACTGCGAATTTTAGTGTAGTTGATGTATTAGTTGTTTTAGTACGGAAGCCTTA
AATGACTAAACGCTGCCCAGCGTAGTACAAGTATAGTAATCTTTGTCTTCGCGAACGCCTTTTACATATAAAGAACGCAAGTATATCTGGTATAAAATCC
AACCGATGGTCTGTCCCTTCCAAATGAAACAAGAGTTTTGAAAGTTTTTTAGGCTTGGGTCATTTGTTGAGGAAGTAGATCACTGTAACAAGCGGATAGT
TGCCAGCACCGGTACCCTCGACCACATTAATATCTTGGAATCTGTAACTGTCCCATAATCAATTGTCCCCAATGAAGACACTTCATGGCATTTCACGTCG
TTGTCCGTACTTGAATCCTGGTAGACAGATGGAGATGAACTTTTAGGATCGACCAGTAGCAAACAACGGAAATTGTCCCTGATCACTCGTTCACCCCATC
CGCGATACCGTGCGCGCCAAATCGATAGGACCCCGAATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTCTACTGCGAAATTAGAGACTGCTATTTAGA
TATGTTGCTGCTTTCATGCATACCAAGAGCAGGCTTGCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGGCTGGTATACAGATTGCAGGTTTTGACAA
GAGCGAAAATATAGTACCATATCCTTTTCTGGCGAAACCTACACGTTTTATGCGACTTCATACAAACTTCTATATTAAAAAATGAATGTCACTACTGGTC
AGATGAATGGAGGAAATTGTTGTTGAGCAGCTCACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATTTTTCAATGGGCCGTGGTAAAGCCCTCACCAAC
CAAGAGTATTGGTGGATCATCGGGCTCCACGACGGCGGGGTCTCGCTACACGACATCTCAAGAAAACCGGCCGCTCTCGCACCTGTGTGCGGAGGGCTAT
CAAGACCGAGCGAGGACCGCAGACCTACAGGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCACTAACTGAGAGGAAGTGCGTGTGCTGGTTCGCACG
GCGGCGTCCGGAGAACACTTCGCAGCGGAGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGCCAACGATACAGAGGATGCTTCAGCGTGTGGACCATC
TTGTGGCGAGGTCGATGAACCTTTACCGCCCAGGGGGTTCGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGAATTGAAGGGGAAGACTTGTAGGAGTCA
ACAAGTATCCAAGATTCCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCGGCTCGTTTGTCTTTGACGAAACGG
CACTTCACCGAGCTTGTGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCTCAACGACAGAATGGCAGAGTGTAGTCTGGATTTCACA
CCCAGATTATCGGAAATTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATACAATACAAATAGCCGTCA
CTTATTCTTTTCGACCCTTGGACGGTGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTATAAACGCGCA
CCACTCTCAATTAGAGAGAAACTATCAAATACTATAGTCAATCGATACACACAGCAAAACTATCACTTCGGGGACAACTGCTAGTCAGTCACCTCGAATA
GCAAGGGAATATGAAATGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTTTGGTCACC
ACCTAACTGGACTTGATGATATGAGGTGGAGATGCTACAGACGACCCGTCCTTAATGGTCGCAGTGCCCCTTTTTGTATCGCGGTCGTAGTCTCGGGTCC
TCCGGATTTCCGTCGGCAGGCTTGGCCGAATTCACTTGCGCAGTACGGGTAAAAACAAACTCTGTTGTTGGCTGTAAGCCTTAAACTATCAACTCTTTCT
AGATCTCGGCTCTGGGTGATTTATCTTGATTTCACTATGTCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAGCTTCAAA
AGTGTCGACTCGACAGTTCTGTTGGGTTCTTTGGCGGTAGTTCAATGGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGTCAGTGGTCA
ACCGTCAAGATTCTGGTATTCTGGAGTCAGGATTTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCCAGCGCACGA
CTTGGGTGTTGGTAGTGGATGATCTTGGTTCAGTATCTTTAGTAGCTCTGAACCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAACTGCACTTT
CCGCCAGGCTTTAGGCACTCATCGTAAGGGAAAGTCCGGGGGCTGGACATAATGCGGGTTTGCAATCGTGGATTTGTACACATCCAGGATACACACTTCC
AGCCAGTTGGGCCCATCGTGGTTAGGCGTAAGATCTTTCCATAAAT