Description :
From Genome Similarity Track
Location :
Scaffold_1357:3150- 7243
Transcript NameFunction/comments
Phyta_totarag12790reverse transcriptase
Phyta_totarag12791hypothetical protein

Sequence
4093 bases(100 bases per row)
AGCAGCCGTCCTGCTGACTTCCGCCGCGCTTTCACAAGTGCTCACCCGCCAGGATCGTGCCTAGCCGTTCCTGCGTTTTCGTGCAACGGCATGGCCTGGA
ACCGGTTATGTCCAGTGCGCTGCCGTAGGAAATCGTACAGCAGTCCTCCACAATTGAGATCCAGCTCATCGAACCCATGTCGTATTGGGACTCACTTCAA
ATTCACGTCGCGTCCGACCATATCGGGGGCCCCATCCCTCTCGCATGTCCCGTATCTGCTCGACCTCGAAAACGTCATCTCCCAACTGCTCAGCTTCCCA
GCTATCCTCCGGGAGgagttcttcgtcaaaaTCGAATCGTGTGTCGGCAGCTACCGTTAGTCGCGCGTCGGGAAATTCCGGACGGCGTTCAGCTTGGAGA
TATGTACAATcgggtacaactggtacgACGTGCCGTTCGTCTCGAGACGCGCGGTGTATGTGTTCACCATCTCAGCGACTCTGAACGGGCTGTGTCACAT
GTGTGCCCGCTTGCGAGCGTACCCCGGTTTCACGCGATCCAAGTAGAGCCACACTTGTCAGCCGGCTTCGATCGGGTGTTCCGTTGCGACCTCGTTCTGG
AGTCGGGCCCTCGCGTTGACTGCGTCTTGGACTAACTCTAACGCTGGTGCTCGCGCGATCTTGTAGTGCCGCTGGATGCGTAGTCTCcagcgcttggcct
ccacgTCGCGATACGACGTATTACCGGCGGCCAGGGCCGCTTCCAGCGTAGATCGCGGGTCCTAACTGTGCACGAGATAAAACGGGTCTCGTTTCTCGTA
CGATCGTGTGCCGTGTTGAGCGCGAAGGTAAGCTCTCCGTGTATTCATCCCAGTCTCGCTGATCGACGTCCGCGATGTGCATCTTAATGGCTCTCGTGAT
CGTTTGCACCAtgcgtcctgcagcaccgtTGGCTTGGTGCCTGTACGCGAGCGTGGCTCGCTGCCTCTGACCCATGCGTTTGCTGAATGCCTTGAAAAAG
TCGGACATGAAGCCCAGCTCACGGTCGTGTCTGatcgcttcgctcgcgcCGAATCGTCTGAAGACGGTCTCTTCGTATGCTTCCGCAACTGTCTGCGCGG
TCCGTGACGCATTCGCCTTTACGATAATGAAGCATGTAAACAGGTCGACCCACACGAGCAACTCGGTGTTGCCCTTGTAAGACACTGGCAACGACGGGAT
GTGGTCCATGGCCATGACTTGGAACGGATACGTCGCCATGATATTGCCTGGTGACTCGCCTTGGATCGTCGGTCTCCCCTTTCTGGTTTCGCAGTCCGTG
CACTCGCCCACAAAACGTTGCACGCTCCTGAAAATCCCTGCCAGTGGAAGTGGCGTCGTAGTGGCTGATACGTCCGGCCGATTCCTTGATGGCCGCCTTC
CAGACTCGCGTGGTAGTGCCTCGCGGAGCGTCTCTGGGaccaccagcttcatgaTCGTGTCGCGTTCTTCAGCCGACTCATCTCCCCTCACATGGTAACA
CAGTAAgccgccttcaccttcttcataTTGGTAGaccatcttgctgcagttcttcgcCTCCCGCCTGGAGAGCTCTCCGATATCGCCGTTCAAATACTTC
TTGAGATTCGTGATCCAcagctcttcatcttggGCGATTCGGATGCGATCTAGCCTGAGTCGCTGTACGACCAGCTCCTGAAGGACTTCTGGTGTCTTAG
CTGGGGTCGACGGGGtccatgctgcagcagaccgGGTGGTTACTGCTTGCGCTTGTGCCACCAAGGGTTTCGCGTCGGCGCGATCTACCGTCGACTGGTG
TAAATCGGGCGTTTCTGGATCGGCTCTTCTTGATCGGACGATCTCTCCGAAACGATCAGATTTTGGATTTCCTCCGGGCTTCGGACCTCTATGCCGCCTT
GACGTTGCAACGCCTGTCCAGCCAGCATATCGACGCTCGCGTTCCAATCTCGGCGTACGTGGAAGAAGTCGTGACGGGGCCATTCTCGTAGCGCGTTCCG
GACTCGCTGCCGGAGCAGCTTCAGGCCTGGTGACTTGAAGTCCATCTCCTCTCGCACCTGTCGGATGGCGAGGTTTGAGTCTCCGCAGACGATCAGCCTC
GAGACGTTCAACCCTTCGAGGAGCGAACATCCGAGCAGCATACCTTGGTATTCCACCTCGTTGACCGTAAGATCTACCGCGTATCCTGACGCAGCACGGA
AGACTTCCCAGCCTGGTAGCTTCCAGATGATCGCGCTAAACGCTCCACATTCTCGCTTGGCGTTGGCAGATCCGTCAAGGCTCATCACGTGGAGCTCTCC
ATCAGGTGTGCTCGTCGGGATTGGGATGACGGCAATTCGCGACGGACGCTTGCGCGGTGCGATCTCTTCCAGGACGGTATCCACGAAGGCTCTGGGTGTA
ATGCTCACAGCTAACGCCCCAAGTATCTCTTCTCCTCCTTTCGTGGACCGGTGAAATCTCTAGCGTACATGGTGAGAGTATGGCGGCCCATTGCGACAGT
CGACCTTGTAGCCCTTTGGATCAGAACAACCACGCCAATGTCGTGTGGCAGGTCAAGCCGCGTATTGATTTCCCAGCCAGCATCGTGAATCAGTTGTTGA
GGATGCGCAGCAAGGCCAGggtctccttctcgacgatgTTATAGTTCAACTCGCTAGGCTTCAACGTGCGACTGATAAATTTCACCGGCAAGTACACGCC
GTCGTGAGCGTGTGTGAGGGCTGCCGAGATCGCCCAGTCGCTGGTGTACACGATTACGACGAGCTCTCGGGTTGAGTTGTAATGCTTCAACATCGGAGTC
TCGGCAAACTTGGCCTTGAGGGTCTCGGATGCACGTGACCCATGCCTTCACTTCTCTTGTTCGCGGATTTCCGGTTTTGCGGCGAATTCGTCGAAGTCGG
TCTCTGTGAGCGAGTACAACGTGGTCGTGTTGATCGCGAAGTCGGCGATGAACCGGGGGGTAGTAGTTTAGACTGCCCAAGAAAGTCTGCAAACCTTTGA
CTGTACGCGGGAATTCCAAGCTCGTGAGCGACTCCAGGTTCTTAGGCTTTGCTTCCAACCCGTGCTCCGACACCTTGTGACCCAGGTAGTTAACCTGAGA
CATTCCTCACGTGCTCTTCTCCACACTGATGGACAAGTGCCATTGATCGCAGACGTCCAGCAGGCGTTCCACTTTCTCGCACAAGTCATCCCATGACGTA
CCACCGATCAAGATATCATCGACGTACGATCGACGGCCTAGAACGGAGTGGATCCCCGGAAGTTCCGGGTTTCCTCCATCGAAGACGCTCCGTGTATCCC
GATCTGGGATCAAGCTCCAGAAGCCATAGAGCGCATTGTCGATCAGTCGCTGGTATATTTGCGGCGTGTTGTACAGTCCGAACGGCATCTGCTGCCATTC
GAACAACCCAAACGGGGTGATGAACGCCGAGGTTAGTCGGGTCTGATCTGTAATGGGGACTACCTAGAATCCGCTGGCCATGTCGAGGGAGTAATACCAC
AGGTACTTGTCCAAGTCTTCCAGCAAGGCATTGACGAGCGGCATCGGATACACCATCAGCTGCGTCAGCCCGTTTACCAGTCTGTAGTCGGTGCAGAGAC
GGATATCGACcccgttcttcttcataATCGTGACGATGGGCGATGCCCACGGAGAAGTCGACAAACGGGACATGCCCGCGTTGAGGAGCCCTTTGAGCAG
GTCGGAgatcttctccttgaactgAGGTGAGAGCTTACGGACGCGTTGCGCCATCGGCTTAGCGTCGCCAACGTCGATGTGACAGACGGCCCTTGTTACT
GCTGGCGGTAATGCATTGCCCTTCCCGATCAGCCATTTTCGCCGCTTCCAAATGATCTTGCGCATCCGGTCTATTCTTCCTGCGCAGCCACCAACGATGT
GACCCAGTTGGTATTCCGATTTTGAGATCTTCGATCTTCACTTCTGCGTTCAGAGAGAGTTCTGACAGAACAGCCATTTCCCCTTCCAATTCTTCTGCGA
AGAGGTCTGATCCTTCGTGGAAGAGTACAGCGTCGTCCGCGTCAATGTCCTTGTCTGGCCCATCCTCCGCTGTATCCACTGGCACCTGATTCA