Description :
From Genome Similarity Track
Location :
Scaffold_2423:315- 2466
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2423-snap-gene-0.1ATP-dependent RNA helicase dbp4

Sequence
2151 bases(100 bases per row)
CGAGATATCCTTGCGGCCGCAAAGACTGGGTCGGGTAAGACGCTGGCGTTTTTGATTCCGATCCTCGAAAAGCTGTACCGGTCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCGTTGAAGACGGACTCGGTGCGCTCGTGATCTCGCCGACGCGCGAGCTCGCGCTGCAGATCTTCGAAGTGCTGCGGTCGCTA
GGAAAAGCGCACTCGTTTTCTGCGGGTCTCGTCATCGGCGGCAAGAATTTCAAAGAGGAGCAGTACCGTTTGATCCGCATGAACATCCTGATCTGCACGC
CCGGTCGATTGTTGCAACATATGGAGCAGACAGCGAACTTTGATCCGTCCAACTTGCAGATCCTGGTGCTCGATGAAGCCGATCGCATTCTCGACATGGG
CTTCCAGCAGCAGCTCACGTCGATCGTCGCGTACCTGCCTGCAGAGCGCCAGACGATGCTTTTCTCGGCGACGCAGACGAAATCCGTCAAGGATCTGGCG
AAACTCAGTCTGAACGAGCCCGAGTACATCGCCGTGCACGAGAAATCGGCGCAGGCAACCCCCAGTGGACTCGCGNNNNNNNNNNNNNNNNNNNNNNNNG
TCGTGTGCGGCCTCGAGCGCAAGCTCGACGTGCTCTTGTCGTTCATCAAGTCGCATCTCAAGCAGAAGACGATCGTGTTTCTCTCGACGTGTCGCCAAGT
GCGCTTTGTGCACCAAGTGTTTTGCAAACTGCAACCTGGTGTGCCACTGCTGGCGCTGCACGGCAAGTACAAGCAGGGCAAGCGTGTTGAGATCTACTAC
GAGTTTCTCAACAAGCCCGCGGCTGTGCTCTTTGCGACTGATATTGCGGCGCGTGGTCTCGATTTCCCACAGGTTGACTGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAGGGTAAAGCGCTGTTGACGCTGTTG
CCGTCGGAAGTGGACGGCATGACCAAGGCGTTCGAGGACGCCAAGATCCCGATCAAGGAGATCAAGGTGAATCCGGCCAAGACCCAGAGCTCGCGCCAAA
AGGTGACATCGGTGGTCGCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAAAGGCGTTTATGTCGTACGTGCGGTCCGTGT
ACCTGCAGCCGAACCGCGAGGTGTTTGACGCGTCCAAGCTGNNNNNNNNNNCGTTGTCGTATGGTCTCCCTGGTGCGCCGCGGATGCCGTTCCTGGCCAA
GATGAAGGAAGATCAGCAGGAAGTGATGCGAGAAGAGTTGCGCGGCAAGAAGAACGTGAACCGCAAGTTACAGATGCTCAAGGACAAGATCAAGGCTGAG
AAGGAGCGCAAGCGGCTCGAGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAAGGACAAGAAGCAAGCAGAAGTGACCGCAGA
GAAGGACGGAAGCGAAAACGAGTCTGATAGCGACGATGGGCTGATGGTCGTCAAGCGCCGCCACAACTGGGACAAGGAAGGCGAAGAAGACGACGACGAG
GAAGAAGCCATTGACTTGGACGCCTCACGCAAGAAGAAGAAGGCCAAGAAGATCCGCGTTGACAACGAAGTGTCGTACAACCGCGTGGTCTTTGACGACG
AAGGCAACAGCATGAAGGTGCTGGAGAAGATGGCGGCACAGCGACTCGACGACGCGACCGCGAGCGAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCCAAGTCGAAGCAATTCCAGGCGTCCGTGGCCGCGCGCCTGAGAGAAAAGGATGCCGAAGATCGCCGACTCGAGAAGGAGCGTGTGC
GCGCCAAGCACCACAAAAAGCGGATGAAAGAGAAGGGCGAGCGCGGTGACGACGACGATGACGACGCGCCCGTGGCCACTCTGGGCAGTGGTTCTTCTAT
GGAGGATGATGATGAGGATATGGAGAGCAGCGATGCAGACAGCAGCGACGATGCCAGTGGTAGCGAGGAGGATGACGAGTCCGAAAGCGAAGAAGAGGAG
ACAGTGAGCAAGAAGAAGATCGCGAGTCGCGACGCCGTCGCGAGCCAAGAA