Description :
From Genome Similarity Track
Location :
Scaffold_2267:315- 2266
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2267-fgenesh-gene-0.0CD27-binding (Siva) protein isoform 1 variant
Pytar_ATCC12531maker-par_contig_2267-snap-gene-0.2Serine protease family S10

Sequence
1951 bases(100 bases per row)
TGATATCAGACGCGATGAGTCGGCTCATGACGGCCGCCACGTCGGCCGCGCGCATGCAGAAGCGCGCGCAGATGACGCTCACGAGTCTCTTTGGTGGGAG
CCGTGCGGTGGACGCGCCGATGGCGACGGTCGCGATGGGTAGCTGTGCCGTGTGTCCAGCGACAGCAACGGCCAAGGCGATGGTGCCACGGACAGAGCTG
CACCGCTGTGCGCACTGCGAGCGAAAGACGGGCGCGTGCTGCAGCCGCGAGTGCGACGGCTGCGCGGGCGTCTTTTGCTCGCACTGCTCAACCATCAAGT
AAGTGTTTGAGCCCCCTCCGTGACCAGGTCGTCATGCCATTCTCATGGAGTTCTCTGTTCTTGTGCAGCTGTGACGAGCAATACGACCGCGTCTTTTGCC
TCTCGTGCAACTACGACTTGTCAAGGTGACCCCGACGGGCGGAGGGTGCGAAAGAGACCGTTGTTGTATTTTGAAATCATTTTTACGTTGTCGCCACCAT
TTTCATACACATGATTGTCCTCTCGTCTCTCTCTTGCGGAGCTCTTGGCAGGACTGCGAGGGGCTCATCATCAGCTGAAGAGCAGGCCGTTCGCTTGGTT
GGGTCTCGTCGTGAAGGAGCGCAACATCTCAAGCGCGACTTGGGGCTGGTCGTGAGGAACCATCTATAGCACGCACCCCCAATGAGCAAGTCAAAGAAGA
CCAGGATAATATTCCTGCAAGAACTCACATGGCCCGACTCGTAGACGCGCACGAGACTGAGCCCGTGGGCACTGCGCACTTCGCCGACCGCTGCACCCTC
GCCTCCGAGGCTAAGCTTTCTGAGCGGACTCTGGCGGAACGCGTCGCGACCCGACCACTCGAGATCGTGGGTCCAGCGGTCCTGCATGTTCCAGTGGGCC
ATCGTGTCGGAATCACCCGCGTACACGAGCACGCGCACGCCATTGTCGAGGAGAAACGCGACATTGCTATCGCTCTGTTCGATAAACTCGACCGGCGGAA
GCTCCCTCATGACCGTCGCGCTGCACATCGACCACTTTTGATCTCCTACGCCGAAGTACTCGAGCGCGTGCTGGTTCACAAAGTCTTCAAGTCGCGACAA
GTAGTAGCACAAGCCGAGCCGGTCGCTTTGATGGCACGCGCGTCGCACGTCGTACATGTTCCGAGCCGCCGCACGCACACCGTCCAATGCCAGCATTTCA
AAGGCAGCAGACGCACTGGCGGCGTCGCGGCATACGCCCGGGTAGTCGCCGTTTTCTAGCGCACGTGCACGCGCGCGCAAGCGATAGCTGCGTCGCGTTG
CGTCGAGACACTCCTGGCTGAGCTTCAGGGCCAGTTGCTGCTTCTCGCGCATCCGTGGCTCCATGGGACCGACCAAGTCGGTCGCGTACTTGTTGCCTTT
GGCAAAATCCAGGTATGTCTGGAGATTAGCTATGGGCGACACTACGCCATTGCCAATGCCCACGCCCTTGATCCTCGAGCGCCACCCTGCATCTCTCTTG
ACGAGTACCGCGGCGAGATCGGGTGCGTAGTGACCACCGTAGCTCTCGCCAAATATGAAGAAATCGTTGTCTCGTAGAGCCGCGTGGTCTTGGTAAAAGC
CGTCGACAAAGTCGGCCAAGTCGTCCATGGCCCGGCGCTCGGTCCATCGGCGCGGGTTCTCGTACTCGGAGCTGAACCCCGTGCCGTGGGGCTGGTCAAT
GAAGATGACGTGCGCGTGGTTCGTCCACGAGTACGCGTTCAGCAGCATTTTGTCGGCCTCATCGTCGAACGTGCACGGGCCGAGTTCAAAGAGCGCGCCG
ACCAAGCCAGAGCAGCCAGGGCCACCGGACAACCACAAGACGAGAGGGATATCTTGAGATGGAGCTGTCGATGACGAATCGAAGAGCACATAGTAGAGAC
CATTGACAAAGCCGGTGTGACGCACGAGCTGTTCACCACAGAGCGACGTCG