Description :
From Genome Similarity Track
Location :
Scaffold_1597:315- 1829
Sequence
1514 bases(100 bases per row)
GATCCACTTTATCACAACTGTATGTCCCTCCTCACCCTTGCATTGGGATTCCTCATACCGTGTTGACTAAGAGCAAGGAGATCTCCAAGTGTATCACGGA
TCTTGACAAGAAGGAGCCCGTCCGAATTCAGTTCCAAGATGATCTCAAGGCTCTGGCATCATTTCATCCCGGTGATCCGAAACACAGGCTTCCCgACCAT
CTGCGTCAGCGTCTCCTGGACTTTGTCGACAACAAGCACTCCGGTTATCCCCCTCCTCCTTACATTGAAGAGGCGCTCTACAAGAAGTTCGCCAAAACAA
GTGCAAGGACGAGACTCATGTCATGAAGGTTGATATCTCCAAGGTCTTGACCACTGAGCAACAGAGAATGGTGGCCGTCTACCATGAGTACCGCAACAAG
TCACACCCGGTAGCTtCTACCTCGCGAAGAGCACGCGTCATTTTAAAAGCCATCGACGAAGCTCTCGGAGCCAGCTCCAAGATTCCAGGTTGTATCGTTT
ACTCTGACTCAGAGGAAGAAGATTCACCTCCAGCCTCTGGTGGGAACACTCCTCTCGAGAGCTCCGAATCGGTTCCTCGAGGTCGTCGCTTAGCAAGTAT
GCGAAGCCGGGAGAAAGCCCGTACCATCCTTATCAACGAGGATTGCATTGCCTCAAATCGTGCTTTGGACTTAGCCCCTTGGTCAAACTTGTAGAGCAAG
TCAGCACAATTCAAATCTGACAGTGAAACCCAAGAGGGTTCTTCGTAACCAAGCCATTTCACCAGGTATTCTTTGGTTCTCTTGGATGTTCGAGTTCTTT
TCACCCACCTCACATCTAGAATCTTCTCGACTTCGAATTCCCCGGCAGTCTCCAGAGGCTCCCAACTGTCCTCGGGCAAGAGTGCCGCGTCGAACTCGTC
GTCTTCATCAATCTCGAGGAGTCGGAGTGTGGGTCTTTCAGGAATATGAATGCGGGCCTTCAGCCGGCTGACATGAACCCATGGAAAAAACCGATATTCA
ACTCCATCCACCTTGAGCTTGTACCGGAACTCGTTATCGGAATCCTTCTCCACAGCCCGTGCCACAAATGTGCGAGTTTCTTCGTGAGGCCTGGTCGAAC
TCGGGGTACATACACCCATACCGCGTCTCCAACTTAGAAaCTCCTAGGgACTGTGTCTGGCAGATTCTGCACCTGGAGATTTCGGACTTCCGCTCGGGCT
TCCTTAGCTTTCATTTGTAAATCTCGAGCCCAGGCCCGGACATACTCGACTTGACGCTGAACGTGGATTCTCCAACGGTATGGATTGACGAGATCGCTAC
GTGTGGGTGCTGGACCGAACATGGCAGCCATGGTCGATTGGGCGTCCcACCCATGCACcAaGAAAAaTGGAGTTtCCTGGCGGGTGTAGTCGTAAGACGT
GTTGAGTGCGAACATGAGCCTTTCACAAACCTCATCCCAGTcACCTTGGGCCGGATCTTCGACGTAAGCTTTGATGGATCTTATGACAGTTTGAACTGAT
CGTTCTTGTTGCCC