Description :
From Genome Similarity Track
Location :
contig_124:31497- 32555
Transcript NameFunction/comments
g11456.t1conserved hypothetical protein

Sequence
1058 bases(100 bases per row)
GATGGCGTACAGGATGACACCGCAGCCGATCATCAACACCGGCGTGTCCATCGTATGCGGCGCAGTCGCCTCCGCGTACGCCATCGTCGGCGCCAGGATC
AGCATCGACAGCAGCACCTGCCAGAAGTTGTCGAACGCGGCGTACTGCAGCGCAGGGAACACCAGCCCAGACACGAACACGCACGCGCTTCCCTCCCAGC
TGCGCGTGTACTTGTTCTTGCTGAAGCAACTGCGCGTCTTGTACTTGTGCTTGCCCCACGTGATGCCCACGGGCTCCGCCAGACCGTCGCCGATTCCCGT
GATGAACACGAGGATGAACGTCAGCGCGCCCTGAGCGGCGAACAGCCACTTGAAGAACATGAGGATGAACATGCCCGGAGCGATGTTGCCCACGATGATC
CACTTGAGCGTGTTCGGGCGATCCTCCGGACGATCCAGCGAGTTGAACTGCAGCATGAAGAACTTGGAGTGCTCACGGATGGGCTTGATGAGCACGAGGA
AGCCCAGCATGGTGAAGAGGTCGCCCCAGGCCAGGGCGATCGGGCCGGAGTAGTCGGACTTGATGACCAGCGGCACCATGTAGGCGGCGAAGTGCTGCAG
CTTCCGAGTGTAGTTGACTTTGAACTTGGACGACTTGTTGGTCATGATGTAGCCCTTCTCGTCGACGTCGCAGAAGCAGCGGCAGATGATACCTCCGAAG
AGGGACACGACCATCATGACCACGAGCTTGGGCAGCTGCATGAGCCAGAAGTGCGGGTCGAGAAGCCACTGCGGCTCGTAGAAGAAGGTGAGAACCAGCA
TCACGGCAGCGTAGACGACCATGCCGACCAGGAAGGCGAAGTCGAACGTGTTGTACCAGTGCTCCTCGTAGTCACCGGCCACCTCGCCCTCCTCGACGAG
CGAGGTCTTGACGGCAGTGATGGGCTGCAGCTGCTCGCCCGTGGCGCCGTACGAGGGCACCGGAGCGCGCACAGGCAACGGCGTAGGCACGCGCCACACG
AGGCGCAGCATGACGTAGCACAGCAGCAGCGCCGCGATGGGCAGCGCAACGAGCACGA