Description :
From Genome Similarity Track
Location :
Scaffold_20:31492- 33194
Sequence
1702 bases(100 bases per row)
CACATCCTGATTGCTAGTGGTAGCGCACTGCCGCCGCCAGCCTACGGTGCGGTATGCGATATCGACACACAGGGGCACGCCCCAATTAAACAGCGTGCCC
GGCGCGTGCCGCTACGATTTCTCGGCAAGCTGTACGAGCTGCTGCGCGCTTTATTGCGTGCAGGACTGATCGTCTTTTCAGACAGTCCATGGGCATCGCC
GATCGTGATTGTGATGAAAAAGAACGGGCTGGACATCCGGCTCTGCATTGATTACAAGATGGTGAATGCTATCACCGCGATCATGGAATATGCAATGCCG
CTAGTCGACGACCTGTTAACAGATCTTGAGCACTACTTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTTGCGAGCGC
GTAAAGTATCGGCGTTCGTCTGCGCACTCGGACATTTCGAGTGGTTACGCATGCCCTTCGGGTTAAAGAACGCGCCGATGATCTATCAGCGTATGATTGA
CAACGCACTCTGGGGGTTCGTTCAACCTAAAGAAGGTTGGTTTGAATATTCGGACAAGATGCGTTTAGCTGAAGAACAAGCCAAGGAACGTCGTGGGCCA
AGCGCCGAGAGTTCGTTTCAAACGAAGTTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTACTACAATTCGTCAACAGCCCCGTCGCTGACA
TGTTTACGAACGGGGAGCCAGACGAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTCTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAG
CTGCCTGGCGACGCTGGACCGATTGCTGGCAAGATTTGCACCGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTCTGCCAACCCAAGGTGGACTTT
CTGTCGCATAAAATTTCGCCAGAAGGCATCAGGGCTGACCCCAAGAAGCTTGCGGCCATCATCGAGCTGTCGTTTCCAACGAGCAAGAAGGGCATGCAGT
CGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATCCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGCCGTTGA
AGGTGGCCTTTCTGTGGCACGTCGTTCCTTCGAAAAATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCAC
GTCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCAATCGGGTGCTAAAGG
AGGCCGAGATGAACTACCATCCTGCTGAGAGGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACATGT
CTATACACGATTCTCGACGTTAGAGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCATTTGCAGTGCTGCTATCGCAGTGGCACCTTAAGG
TGCAGCGCGTGAAGGAGAAGGATGTCGCCTTCGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTCGACCTGGAAGACTCTCTCGCGCCGATGGCACC
TCCAAACAAGGGTTCCCCGACTATTCGAATGGACCCCGCGTTGCTGTACGCCAAGCTTTCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGATCA
GC