Description :
From Genome Similarity Track
Location :
Scaffold_1373:3149- 7076
Transcript NameFunction/comments
Phypl_g13247hypothetical protein

Sequence
3927 bases(100 bases per row)
ACTCGTGCATCAACGTTCCACAATTCAGCTGAGACATAGGAAGTCACTCAGACTCTGATTAACCTTTCCATCTCACCAAGCACTCTCGGACCGGTCTCGA
AGTCCGAGTACGTTTCACCCAGCGAATGTCACGGATAGCCTCCATCTCGTATACACTCTGAGCTTCATTGACCCCAGACAAACCTTTCGGCAAGAGAGCC
GCATCCAGATCGTCTCCTTCAGCGACATCGATCTCAGCCGTAGGGCGGTCTGAGAACAGAGCGCGCGGTATGAGTCGACTAATGTGGACCCAAGGGTACA
ACTTGTATCCGGATCCCTCAATTCTCAGCCTACACCAAAGATCATCTGAAGTCTCAATAATGCGAAATGGGGCATGCCACAGGTGGGCGAACTTCTTGGT
TAGTCCAAGCTGGACTCGAGCCAGGTACAGCCATACGGTGTCCCCGACTTCAAAGCCTTTCTTGAGCCTCTCAGTCAGCTCGAGCCAAATCTTGGTCTGG
GCTTCTGAGCGTTTCAGCTTCGCCTTGGCTTGCAAGTCCTTTGCCCAGGCTCGCGCATATTCGTACTGACGTTGAACCTTTCGGCGCCACTCGTATGCAG
TCCGTTGACCCAGTCCTGAAGGCGGTGATCCGAGCATAGCCGAAACTGTGCTCTGAGGGTCCCAGCCATGGACCAGGTAGAACGGGGTGTCTAGACGAGT
GGCATCAAAGGACGTATTCAGGGCCCACATCAGCTTCTCGACCTGGTCGTCCCAGTCACTTTGGTCCGGCTCTGAGACGTAGGCTCGCACAGCTCGAACC
ACAGTCTGCACAGACCGTTCTTGTTGGCCATTGGCCTGAGGACGATATGCCAGCGTGGCCCGTTGCTGACTACCCAGCATCTCTCGGAACTTGGTGAAGA
CTTCATTCATGAAACGGGGGTCCCGGTCGTGGCAAAGTATGACACTTGCCCCAAACCGCTGAAACACGCATTCCATGTAGGCTTCGGCCACTTCCTGAGC
TGTAGTGACGCTCATAGGTCGGCAAATTACGAACCCGCAGAACGAACACTGGAACAACAACAGGAAGACGTCATCTCGATCAGACTTGGGCAGATGCGTC
ACGAAATCCACAGAGATCACCTCAAACGGCCGAGTTGCCAAAATGTTACCAGGTGACGGCCCAGGGTTGGGCGGCACTCCTTTTAGCCGTGACGCAATCC
ACGCATTCCTTGACGTAATGTTCCACGTCAGCATACATCCCCGGCCAATAGTACTCTTGGCGTAAGCGCTCGAAAGTCCGAGTTACTCCTTGATGTCCGC
CCTGAAAGTCCTCGTaactcagctgcagcaggtctcGTCTGAGTGCAGTGGGAACCACTAGTCTCAGATTACCTGCCGCGTCTCGAGGCCGATTCGGGGT
GGGCCGGCTCAGATAATACAACGCTCCGCGTGAGTCAAGCACAAACTGGTCTGCTACCTTAGCCAtctcttcagcttctgccGTCGACAACCTTCCCAGA
TCCCTTTTCAGATAGGCACTGAGCCGTCTCGTCCAGGgctcagcgtcttgctgTGCCAGGATGCGTCGCCAACGCTCAGCCATAGGCGAGCTTGGTGTAG
CAGATTCCGCTGAGAACGTCTCCTCCAAGGGGTCGTTCGGAGCTCTTGCTGCGTCGTCCCTGGCCTCAGATGATTCCGCGTCTTGGCTgacaacaccagc
agcttcctgaGTGCGGGCCTGATTTCGAGTGACCACGAAGATCTTAGCTGCTGGGGCTTGAGGCTCCACCGCTGCCTCGATGGACACAGGCTCAGCTACA
AGATTCCTCGGCTCAGAGTCTGGGATAGGGTCTGGATTTGGTCGCTCAGatccagctccagccgaTTTCACCAACTTCTCCTGGATACGATTCAGTTGTC
TGAGCTGAGTGAGTTCCAGCAAGTCCTCAACCGTCACAGCGGTCCGAGCGTCCAACGTCTTGGTCGTGATGTAATCCGCCGCGGCATTGAATTCTCGCTT
GACGTGAACTAACTTCAACGATCGAAACTTCCGACGAAGCGCCTCAAactcgctcagcagcaactggagTCCGGGCTTCAGACACTGGATTAGACCTTGG
GCCTGCTGAATAGCAATTCGAGAATCGTCTACTACCACTAGGTCTGAGATCCCACGATCAAACGCCATTCGTGTTCCTTCGATCATGCCATGATACTCAG
CTTCATTTACCGTAATGCCATCAAAGTGGAAATCACGAGCTTCAACTACCTCCCAGGACGGGAGCTTCCACAAGACACACCCAGAACTGCCTCGCCGATC
TGAGAGCTTAGCTGCACCATCAAAGCTGAGCAACCAGCCCTCGTAATCAGCCCCGAGCATCTCCAGACTTATCGGTGGAACCCGGACTACACGTCCCTTG
GCTGGGATGAGATTCTCAGCAATCCTGTCCAACTGGTCTCGTGGAGTGATCCCAGCTCCCATGATTGCAGCTAATCCATCCTCATCGGACTTGATTCGGT
GAATTTCCAAAGGCCACGGGGCCAACCGAGCCGCCCACTGTTCACAGCGCCCTTCCAACGACCGAGACCGGAAGATCCACTTCAGCACCGAATACCGCGT
GAAGACTTTCAGTAATTTCCCATCTGACAACATGGTGTAGAAGATGCGGAGAACTCGGAGCAAAGCGACAATTTCCTTCTCAGCCGGATGGTACCTGAAC
TCTTGATCATGGAGCACTCTCCCAGTATACCGAACTGGGCGGATGATTCCATCATATTCTTGGCCCAGCACAGCGCTGACAGCCCAGGGATTCGCGTGAA
CGATAATCACGAACGGCTTCTCCCTATCGGGGTGTCTGAGCAGTGGGGTAGACACGATCTTCTGCTTCAAAATCTCAAACGCTGCCTTAGCTCGGCTCAG
ATCTCGGCCGGCTCGGATCTGCTCGTCTGTCAGCTCATAAAGTACCGAGGCCACAACCGGAAGGTCTTCAATAAACTTGTTGTAATAGTTCAGATTTCCC
AGAAATGACTGGACTCCTTTCAGCGTCGACGGGAACGGGAGCTCTCGTACATCCTTTGCGATTTTGGGTTTGGCTCTATCTCTTCAGTCCCAATTTCATG
AGACAAGTAGGAAATCGTCTTCTTACCAAATTCACTCTTGGGCAAACTCACCGAAATCCCCCAGTATCTCAGCCGATACAACAACCGATCCAAGTCGACA
CACATCTGTTCCCAGGTCTCAGCTCCATACGCAATATCGTCGATATACGAACTTCGTCCCAGGACTGGGTTCAACACAGGCGGAGCCGGGAGGTTCCTTC
GGAAGACGGTCATTTCCTCAGATAGTACTCGCATGTCGCTTTCCTTATCTGAAGCTTCAACCTCAATTCCCAGAAACTCCAAAACGGCCGCTTCTACCTG
AGCCTCTTCGCCGGGCGGGAGCCGAACGAAACCCCAAAGACAGTTATCCAGCATATGCTGATAGATGAGCGGCGCGCTCTTCAGCCCAAATGGCATTCGC
TTCCACTGGAAGTGACCTAACGAGCAAAGGAAAGCTGAGATGTGCTTGGCTCTGAGAGCCATCGGCACTACCCAGAACCCACTCGCCATGTCCAAGCTGA
GAAACCACATCGCATTCTCAAACCCAATCAACAGATCGTCAATCAAAGGCAGAGGGTAATGCATGAGCTTGACCAGCTGGTTCACCAATCGGTAGTCAAT
ACAGAGCCGAATGTCGACTcggttcttcttcatcacaATGACGATCGGTGACGCCCAACCTGAGGCTGAATACTCGATAAGCCCAGTCTCCAGCAGTTTC
CTCAGCAACTCATACACCTTGTTGAGGTGGTGGGGCGGAATCTGCCTAGACCTCTGGGCAATTGGTTGAGCGTCACCCACGTCCACGTCACAGACCACTC
CTCGAGCTAGGGACGGCACTGCGTTCC