Description :
From Genome Similarity Track
Location :
Scaffold_66:31486- 34244
Transcript NameFunction/comments
Hyaar_Emoy2807581AlNc14C108G6310
Hyaar_Emoy2807582Tcomplex protein 1 subunit zeta putative
Hyaar_Emoy2807583PREDICTED: uncharacterized protein LOC100250368

Sequence
2758 bases(100 bases per row)
ACACACTTTCTTCCGCTTCGATCGAGTGGCTATCATCTGTAAGAGGTGGCGCACTTGGCTCGTCATGCCCGACGTTTCTGACACCACCCCCTTCATCTCG
TGGAGCTGGGAGTGCTGCAACTCCAGGTCAACGAGAACGTTTTTGGCCACTTCTTCCGACTCCTCGACAGTGCGTCGCGTACGCTCGATGTTGTCGGATG
TGCGCATGAGCGACTGAATGCTCTTTATCATGTCGAGCCAAGACCAACAAGCACATACAAAAGTTATTATTCTCTGCATCCAATTCGTTCGATATCTAAG
CGCTATTGACACACCTGATCCGTCGTGAGGAAGGTGTTGTAGTTGTTTCTATTATTTTTGGTGGAGTGCGGTCCCCCACCGATGACGCCACTGCCATTTC
CAGCCGCAAAGATACCACCACCACCATCGTCGTGTGCCTTCGACATGATGCGACTACGAGTACAATAGCCGTTCAAAACTAATTGCTGACTTTTGTACGA
CTGGTCGTACACACTATTTTTAGTGACGCGATGCGTGTGACATGTGTGGATGATTGTTTCCTTGATGTACCGTACACAATTTACATTTCTTGTCCCGCAT
GAGCTTTGGCAAGACCAATTATCGCGTGGGCGGCACCCGCGGTGGCGCGAACGGTACGACTTGTGCTCACTATACACCTTATGGTTAACTGGTGAACTAT
AAACATTCAGAACGTGCATACGCGTGCTCATTTTTTTCTTCCATTTCATCCCTTGCTCTCTCTCGTGTCAGAATTTAACTGGGAAGACGTCAAGAACGAC
AAGTACCGGGAGAATTACTTGGGGCACTCGGTACAGGCGCCCGTTGGTCGTTGGCAAAAAGGGAAGGACTTGTCATGGTATGCGAAGGCCAATAAATTAC
AGCGGGATGAAGCTCTGCAGTCAGAGTTGATGCTGGCCAAGCAGAGAGACGAAGATCTCATGAACGAAGCTCTGTACGGATCGTAGCAGAATATCGATTA
TTGGATATTTGGGTACAAGCTTATGGTATTGTATTCCTGATATTTTGCTACTTCGATGCAATGACAGAGGCATTGCACCCAGAAGACGTCATGTAGCTGC
TGAAGGTTTGAGCTCGTCGGAAGTAAAGGAGCTGCTGAAACGCGGAGAATCCGAGCGCGATGGTATGAACGTTGAACGGATCGAAGGGTTGGGCGCTGCA
CCAGTGGAAGCTGCAGGTTTTGGAACGGGACCGAAACGTACATTGGCTGAGAGGTACAAGGATCAACTTGCGAGTGGCAACGCAGAAACGACATATGCGC
TGCCTGGTACAGGAACTGAGCCGCTAACGGAGAAGGAAGCAAAGGCTGAGCGGAAGAAAATGCGCAAGGCGGAGAGGGATGCAAACAAACGAAAAACAAA
GAAGGAGAAGAAAGACCGCAAGAAAGAGGAAAAAGCACAGCGCAAAAACGTTCGTGATTCTGGGGACGACGGCGACAAGAAGCCGCGTCATGTGCGGCTT
GACCGAGATGATAAAGATACCGGAATTCGCTCGCGATCTTGTTCTCGCTCGCCTCCTAGGCATTCAGGAAAAAGTCGTGATGCAGCTCGACGATCACACA
CTGAAAACCGACACCGCAGCGGTCGTTTTCATTCGCGCTCACCACCCAATCGTCGCAAGTATGCAAGTTCGTCAAAAAGAGCGGAGCCGCTGGTTCCCCG
TGGCCACGCGCGGTATCCAGACAGGCTTCGCCGTCATCACTACCGATCGTCATCTCGATCTCCTGCTTCAACAAGACGCTCACACTCTCGTTCCCGGTCG
CGTCGCGGCTACTAGTCAGCCGTCATCCGAAATATACAATTGACGTGTTATTTCTTTTCTGCTTCTATTCTCCCGGTTGGTCGTGAAAGTAGCTAGCTAG
CAAGCTGGCTCTCTATCATTCCGCTTACTCGGGCTTGGATGTCGTATGCGCCTTCTTCTGTCGCCCACAGCGCTCAGAGCTGCCATCCTTAAGCTCGTAC
GCAGGCAAATAGTGTCCACCCTGACCGCCCTCGCCTTTTCGCCAGAGCTCTGGGTTCTGCACAGTGTCAAAGATGTTGCCTAGCGAAGTGTACCCATGAT
CGTACAGCACACAGTATTCCAGCTCACAGTCACGTAAGAAGCTCCAGACGTCCGCGTACGTCCACCGCAAGATCGGGTTCACCCGCAAAAACGGCGGCCA
CCCCGAACTGCTCGGCGAAAAGTGCTCCATGTCCTCCGTATGTGGATCTCCTCCCCGCACGCCCATATAAATGCCCTTGATCTTGAGTTTCTCCAACATC
TCCTTCACGCCTTCGACGAACGAGCACTTGTACACATGGCAATTCAGCGCGTATTTCTTCGAACACGCTTCGGTAAAGTCCCGGACCTCTGGGAACTGCG
CGGACGAGTCAAAGTACATGACTGGCACGCGTTGCAATTGCGCACGGACGCGTTCTTCCAGCTCCTCTTCTTGCAACAAGTCAGCCGAGACAAAACTGTT
TCGTGGCGATGTCACAGTCGTGCCGCCTTGCGCTTCCTGTTGTCGCTTCACATCCTTCAGCTGTGTCTCTTCCAACACTTGCTTGGCGACTACAATGCGG
AGCAAGTGGAGCAACACTGTCGAGTCTTTTCCGCCGTTAAAACTAAAGCACACGCCCTCAAGACCGAAAATGTCAATGGCACTGCGTACGACGTCCAGTG
CCTTTTGCAGTCGCGTCTGCATTGCTAAATCAGCACCAGCGAAAAAGAGATCGAAGCG