Description :
From Genome Similarity Track
Location :
Scaffold_285:31484- 32693
Sequence
1209 bases(100 bases per row)
ATCTTCTGACAAAGCATGCCAGAAGATGACTCCACACTTACGCGCTCGTGCACACCGTTATCGAGTGCAAGACGGCTTACGGATGTATAGCGCTGTCGAT
AACAACGCGGGTCACAGTGTCGTGCATAATGACCATGACCTGCGGCTCAGGGTCATGTACGAGTACCATGATGCCCCTACGACAGGGCATCCGGGTCGTG
AGAAGACGTACGTTCTCCTCACGCGTCACTGCTACTGGACGCACCAGTACAAATGGGTGCGCAAGTAAACTCGTGATTGCGAAGTATGTCAGCGCGTGAA
GCCTGCTCCGTTCTCGCAGGCTCCACTACAGTCACCCCCAACTCTGTCGGAGTGCTGGCAGTCCATCTCGATGGACTTCATCTTTGGTCTTCCGCTTGAT
GCCAAGCGGAGGACTGACGCAGTGGTATTTGTAGACCGTTTCAGCAAGATGNTCGTTCCACCACTGGAGCAACTGCTTGCCGATGGCGgagttcgccatc
aacaacttGGTGCATGCCTCGACTGGGCATATACACCGTTCTACGTGAACGCCATGCGACATCCACGCGTGCCAAGCATGCTCGGGGCGGTGGCTTCCTC
TTTAACTGTGGGATGATATACGGCTGCAAACCGGTAACCGCAGGAAACAACTCATACAGTCACAGTATCAGTTGCGACGACGGGCAAAAACACCGTGTTT
GTACCGGGCACAGACACCGCGAAGGAACACGCACATGCCGGGCCTGCTGCGAACGACAAACACGCACAAGCGGGGCTTGTAGCGAAGCGCATACACACAC
AGGCAGAGCCTGTAGCGAAAAACAACAACCAGATGTCTGCACCTTTCGCAGACACACGCACAATCCGGGACTGTAGCGGAAGTCGCAGTCGAGCTGAACA
AGGCATTCAGCTCGGAAGCAATGGGCTTGATCCAGCGCAGCCAAGCCGTCATTCGGTTTGTCCAAGATGCAATAGCAGCTGATAATGTTGGCAGGGGCGA
TATAAATGAATTCAAAAAGAGGCCATTGGTTCTGTTAGCTACGCAAACTCAGCTAAACATACAGTCTCTGACTTGATAGCAAGCAAGCTTGCTCCGCGCT
TCATCGGTCCATTCACCGTGCCCGAGCGGCACGGCAACACCTACACGTTGGACACACCGTCCCCCATGCACCTCCATCTGACTTTCTACGCCAGCCTCCC
CAAAACGTA