Description :
From Genome Similarity Track
Location :
Scaffold_167:3148- 6163
Transcript NameFunction/comments
Physo_144116hypothetical protein

Sequence
3015 bases(100 bases per row)
CACTTCAGGTATTCCTGGTGCGTGTTGGTCACGTATTTCGTGTTGGGGCAGAACACCACACCATCCGTGTAGTGCACACGCTTGTCGTCACTGTAGATGC
GCGCCATGCTGTGGTCGCGCTTCTGGACTCGCTGGATCTGACGGAACACCTCCATGATGTGGCGGTGCGGCACCCACTTCTTGCGCAAGATCAGCATGAT
CGCGTGCCGGTTGATGTCCAGGTTACGAATGCCCGAAGCATAAGGGCCCCTGCATTAATAATGCAAACCCAGAAGCAGTAAGTAACAGCACAATAGGGAC
ACCAATGCTCAGACATGTAAAACGCACTCTTCCGACAGGAAATCGTTCAATATCCTGAGACGCTCGACGAACGGCTTGTCCACGTGAGAGTCCTCTGCCG
AAGGACCTGTCGCGATTATGTCGAAAGCGATGAACACGTAGCGCTTGTCCTTCTGGTGGAACTGCAACGTGTAACCAAACGCATTAGAATACCGATAAAA
ATTCAGTCCATGCAGCGGAGCTTACCACAAGTTCGCCATCGAGCACCGTGCCTTCAGGCAGCACCAACTTCAACAAGTCCAAGCCCGATGCGGCAAAAGG
GGAGTTGGAGCGGTCTACCAGCACTGTAGTGCCTCCGGCTACAACCAGGAAATAGCGAACGCCGTCCGTCTTCTCGGAAACGAAGTACTCGCGACTCTGC
ACAAGTGGAATATGCCAACGCGCGAAGCCCACGGGCATCGTGCCACTGAATTTGCCGCGGATGCCCAGACGGCCCTGGTAGGCGTTTTGCACCTCAGTGG
CGCCTGGGAAGTCCCAGTGGCGCTTGAACGCCTGGCCAGAGTTCGGCATGAAGTACTTCACCATCTTCCACAGCAAGGACGACGTCTCGATCGCGCTCTT
CCAGCTCTGTCCGTTTTCATCGGGCTGGCTGAGCCACCCGTTCACCGCCGGCTCGCTGAGCTCCACCTCCACCTCGTACGACTTCTTGTTCGTGCTCTCC
TCGAGCACCTTGGTGAGGTCGACACGCAGGTCCCGTCCGACGGCTGAGACGCGGTCCTTGTGGCGGATGTTCTCGGCCGCCGGCATCTCGCTCATGTCTC
CCTCCAGCTCCCGCATAGGGAACTCGCACGAGATAGACACGCGGCAGTCGTACTGGCAGTGCGGCATGAAGATGTCGATGGAACCGAGGCGCTCCTTCAC
CTGCACCATGGGCTTGCCGCGCATGTTGCTCTGCGGGTCCACGTCCTGCACCACGCGCTTGGACTGCGCCATGTTGTGCACCACCTGCTTCTCCTTGTGC
TCCGAGTAGGCGTCTCCGCGCAGCATGCCCTCCACGCCGCGCACGAAGCCCTTGTAGTCCAGCTCGGCCACGCCGGGGACGAACTTGGCGCCCACGGCCT
TCATCTGCGCGTCCGAGAGCACCACGGCGGCGTCCACGCCCTCCTGGGACGGGCGGCAGCGCGCCTCCTGCAGACACGACGTGATGCGGCCGAGCCGCAG
CTCCACCTCCACGTTGGCGCCGAAGCCCTTCTCGTCGATGAGCGCGCGCATGTCCTGAAGGAACTGGGCGATGGCGGCGTCGGGCGCGGCCGAGTTGTCG
TCCACGGCGATGGTCTGGCCGCGGCCGGCCGTGAGCTTGGCCACCTGCGCCTCCGCCTTCTTGGCCGTGAGCGCCGACTCGTTCGTGCGCGACAGCGAGC
TGAGCATGCTGTTGAGCACGCCGCCCGACGAGATCTTGGAGTGCGCGCGCTTGGACATGGCTGCGGAGGAGCGAGGGAGCGCGACTAGCAAGGCGGCAGG
AAGGCGGGCTGCTTGGACCTCGGCTTCTCAAGCAATTGTGGGGGGACAAACTAGAGACTATGTGGTTTGGAAGGTCTGTGTATTTGTTATGGGAGGTCCA
GTGTAGACCACTTCTTTGTTGAAGTTGACCGCCCACAGTGAAGCTCCACTGGTTGGCACGAACTTGAAGCGATAGTCTGTCCAATCTTATTTTGTGGTCA
AAAATGGCCCTGGGCCGCTAACCCGTTTCTTCTAAACGGATATCACGTAAGTAAATGCGGGTATGGACCCTTGAAAAAGCTAAGTAAAAGTGAGTGCATC
AATGTTTGGGGGGACTTCGTCCCCGATGAGTGACAGTGAGCAGCACTACAATACTCCTGCCATATACCGCGCATGCAAACACTGTGCTCCTGTCGGCGTA
CCGAAATGTGCTGTAAGGGTGCGTTTGATGCTGCTGTTCTGGGTTTTTATCAATTGAAGACTTGTGTAGAGCTCCAAACTCGTTGGTGGTCCCAGTGTAG
AATGGAATCTTGTGCTTTCTTCTTGCATCGGCGTCTGCTTTTACGTTCCCGCGGTTGGTAAGAGCAACCGTGGTGTAGCATTCGCAAACCTCAAAATACT
TTTGATCCTACTCATAACTTAAATTAACAAAGCCCATGGCAGAAGACGGTTATCGACACTTTATATTTGAGTCGATCATTACGCAGACAAACGGGAATCG
TGTGCAGTTCCAGGCAAAGTAGAAGGTACGTTCAATGACCGCGGCAACACCCAATTATGGATAGACTGCAACTTCGCGCGGGTGACCTGGTGGGGTTAGA
AGTTAGGAAAAGAGGAACCGGCGTCGCTTCGCGGCACATTACTCCGGCAGTTTTTTATTTTCCCCATTTCTTACCGTAATTTACTAACTAGACTCGTTCT
AGAGCACACCTTCATAAAATTAGTAAATAAATCGACAGCACCTCTAGATAGCTCCATATTGCTTAAAGAGCTTTAAGCTATCAGAACGAACCCCATTCAG
TCTTCATCTCGAATTTGAATCAGCTCGACTCGCAATAATTACTGGCACATTACGACGTCAATTTTATGAAATTGATAGAAAATTCATTTGATCCTGATAT
GTAAATATTATAGATATATAATAGCTACTACTAGTAATCACAATGTGCAACTACATCTTGGAAAGTGGAGCAACGTGTAAGGCGAAGCCAGCCCAAGATC
GTTGTGGGAGACACC