Description :
From Genome Similarity Track
Location :
Scaffold_343:31479- 34665
Transcript NameFunction/comments
g16314.t1hypothetical protein
g16315.t1hypothetical protein

Sequence
3186 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGAATACATTCAGGTTGACCACTCCACAAGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAA
AGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAA
ACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAAT
TTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAG
TCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCACTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTC
TGCAATGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAATCATTGGGGAAGCGGCGGTAGCA
ACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAAGTACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGC
CATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACAC
TGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGA
CTCACAGATCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGT
TCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGAC
AAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAA
TGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAAT
GGACCTCTCGAGTGCGACGGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGATGCGGAAACATCGGTCACTATGCCCGCGAG
TGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAACTAGAGGGACCAGCAGGCGCGGGGCGCCC
TGCTCGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAG
CCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAAAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAGCAACTTTGTTCGACTGCAGAGCC
TTCCAAGGCTTGACTTCGAGGAAGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACG
CGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGATGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCA
CGGCATGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATG
CACCACGTGGTGCATGCGACCCTCCATCAGAGACATCGCGGAATGCGGCTGTCTCCGGTCACCCGAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAG
AAGATGTGAAACGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGTGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACA
CAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTC
CCGCATCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGATGCGCGATCAAGCCGGGCTTGAACGCGTGCACCCGCGGGTAAAACC
CGCCGGCGAATACAAGGAACAACTGTCCACAGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAA
AAGCTGCGCAAGTCTCGGTCAGGGACCGAGATGCTACCAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGA
CGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGACAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCG
TTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGCGTGAAGCAGAAGAGCTGAATCAGCTCATC
TCTGAGGGCGCGGACGCCCTCAGCGTGAAGTCGAAGAAGGAACGCTTCGACGAGCTAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGC
GTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGACCTCGTGCCGGGAACGAACTATTG
CGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGCCTTCTTTGGAAGTCGTTGCAAGGCAGGACAAGTGCGGGAATCGAAGTCC
CCGCACAGCGCGCTTACGTTCCGTGTCAAGAAGCCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGAC