Description :
From Genome Similarity Track
Location :
Scaffold_1341:3147- 6929
Transcript NameFunction/comments
Phypl_g13154hypothetical protein

Sequence
3782 bases(100 bases per row)
CTGCATAGCCTGGAAACGAGCTCTTGCTCGAGCCCCTGGTTAAACTCATACAGGAGGGCACCGCAGCTCAACTGCGTGACTGGTAACCACTCAAGATCAT
CATATCCTTTCCACTTGACGAGATATtcacgaaggcggcgagaAGTCCGGGTGCGTTTAGTCCATCGCAGGTCCAAAATTTTCTCCACCTCATACTCATC
GCTCTGGGTGTCGGCCTCTCAACTGTCTTCGGGTAACAGTGTGGCATCAAAgtcatcatcttcagccacttcaacttcctcaGATGGGCGTTTTGGAAAC
AGCGCTCGGGGCTTCAGTCGGCTTACGTGCACCCATGGATTCACGCGATAACCTGTGTCCTTGACCTTCAGCTTGACCCTGAAGCCGTCATGGATCTCGT
CAATCCTGAACGGACCCTGCCACATTGGGCCAACTTTCGGCGCAATCCTGTCTGAACCTTGGGTATGTAAAGCCAGACGGCATCACCTTCTTTGAAACCA
GCCTTGATGCGATCAGGCAAGTCTTCCCAGTTCTTGGTTTGAGCCTCTGACCTCATatgcttggccttcttcggtAAGTCTTCAGCGCAGGCCTGGGCGT
AGCTGTAGTCTCACCGCAGTTTTCGACGCCACTCAAACGCACTGCGTTCAGGTACACTGGACGGCTTGGGCCCAAGCATCGCTGAAAGAGTGCCCTGGGT
GTCCCAACCGTGCGCAAGGTAAAATGGTGTATCCAGTCGAGTCGCATCAAATGACGATTTCAGCGCGAACATCAGTCGCTCAGCGTGGTCATCCCAGTCA
CTCTGGTCAGCCTCCACGACATAGCTCTGATGCTCCGTACAACAGTCTGAACAGAGCGTTCCTGTTGACCGTTCACCTGTAGGCGGTAGGCCAAGGTTGC
TCGTTGTCTGCTACCAAGCATCTCTCTGAAACGGGTGAAAACCTCGCTCATGAACCTTGAGTCTTGGTCGTGGCGCAGCATAGAACTTGCTCCAAAGCGC
CTGAACACGCATTCTTCATTAGCTTCAGCGACATCCTGAGCCGTTGTTGAGCTCATCGGTTTACACATCACAAAGCCTGAAAACGAGTCCTGAAACAGGA
GCAGAAAAGTATTTCCGCGTTCAGACTTTGGCATGTGAGTGACGAAATCCATCGACACAAGCTCAAACAGACGTCGGGGTGCAATATTACCAAGTGACGG
ACCAGGGTTCAGAGATCGTCCCTTGGCCGACGCGCAATCGGAACACTCCTTGACGAACACTTCCACATCAGCGTACATACGCGGCCAGTAAAACTCTGAA
CGCAGCTTTTCCTACGTTCGCGTGATGCCTTAATGCCCACCTTGGTAGTCCTCATGAACGTAATGCAATATGTCTGGACGCAGATCAGTCGGTACAACTA
ACTTCAGCTCGGACTCTTTGTCCCGCGGGCGATCCCTAGTGGCCACGCTCAGGTGGTAGAGGACGTCCCGGGAGTCGAAGACGTACTGGTCGGCATActt
ggcgatcttcttgacCTGATAGCGGGTAAATTGGTCAAGCTCTCCTTTCAGGTAGGACTTTATCTTCACCAAGAGTGAATCTCCATCTTGGTGCGCTTTA
ATCCTTCGCCATCGTTCCGCCTGGTATTCCAGCGGTCCCATCGCCCCGGCTTGCGGTAACTCCTGTTGTGACCGAGCGCGGGTTATTGCAGCCATAACTT
TGGCCGCAGTCGACAGAGGGGCTGAACGCACATCTGCGTCCAGGGCTTTCGCATCAACCAAACCTGTACTCGGATCTTCCGTGTCCATCACAACTGCCTG
CGGGTCCTCTTCCGACTTCATCAACTTTTCAGGTATCTTGGAGACCAATTCTAAATGCAGTCgctctccagcatcttcaacCTGCCAAGATTCACCCAAC
AACAGGGTCTTGGACGTCAGATAATCCGCGGCTTGGCTGTACAAGCGCTTGACATGAATCAACCGCAGAGTCTTGAACTTGGGTTTGAgagcttcgactt
cagcgaGTCTGCGTTGAAGGTTCGACTAATGGCAATTGATCATACCCTGGGCTTGCTGAATCACAATCCGCGAGTCTCCAACTGCAACCAAATCCTCAAC
GCCTCGCTCAATAGCCATAGCTAGACCTTTTAAGAGCCCACGATACTCAGCGTTATTCACAGTCACGTCATTGAGGATAAATCCTCGAGCATTAGCCACA
TGCCAACCAGGCAATTGCCACAGAACACATCCACAGCTTCCGTGACGAGTCGAAATTTTGGCCGCACCATCAAAACTCCGCACAATACCTTGGTAATCCG
ATTCAAGCATCTCAATGCTGAACGCAGGTATTTGCTTGACTCGTCCCTTGGCCGGAATCAGTTCTTGAGCGACTGCGTCCAATCGTTCGCGAGGGGTGAT
AGCAGCACTAGATCATCAGTGGAAATTCTAAGCCATAGATCAGTGGTCGAAACAGGTCTAAGACTCGCAGGATTGCCAGAACCTCCTTCTCAGCAATGTG
ATATCTCACCTCCGACTCGTTCAGGACACGCCCAGTGAAACGCACCGGCTGATTGACTCCTTCGTGTACTTGTCCCAACACCGCACATGCCGCCCAAGGG
TTGGCATGCGGTATAATGATAAACTGCTTGGCGCGATCAGGGTGTCGTAGTAGTGGAGTCGAAACAATCTTACGCTTCAGGATCTCAAATGCTTCCTTAG
CCCGAGCGAGGTCTCGCCCTGAACGTACTTGTCCATCGTTCAGCTCGTAAAGAACTGCAGCCACCACAGGGAGATCTTCGATGAATTTGTTATAATAGTT
CAGGCTCCCAAGGAATGACTGAACTCCATTCAGCGTGGATGGAAACGGCAAGTCTTGAACGGACTTCGCAATCTTAGGCGTAGCTCGAATTCCTTCAACA
TTAATCTCATGCGACAGGTACGGGGCGGTCAACTTGCCAAACTCGCTTTTCGGGAGACTCACAGAGATATTCCAATACCGTAACCGAAACAGGAGCGCAT
TCAAGTCCTCACATAGTTGATCCCAGGTAGGAGTACCATGTGCGATATCATCAATATACTAACTGCGTCCAAGGACGGGACCCATCTGCGGGGGAGCAGG
GATGTTTCGCTTGAAAGCTGTCATCTGCTTCATCGGTATGGGAAGCTTAGTCGCCTTGCGTTCAGAATCTTGGTCGCATGTGTGTTGAGAACCCTGAACG
CAGGTACGCCCAGAGTCGGGCACATCCAAGTCCAAGAATTCCAAGACATCTTGGTCAACCTGGGCCTCCTATTCGGGCGGCAGCCGAACGAATCCCCACA
GGCAGTTGTTGATCACTGCTTGGTGCGTTCTTGAGTCCGAACGGCATTCGGATCCACTGGAAGTGTCCAAGCGGGCAAATAAATGCCGATATCAGCTTTG
CACGCTCAGTCATGAGCACCGCCCAGAAGCCACTAGCCATATCTAAGCTCATGAACCACATCGCGGACTCGAAACCAATCAGCAAGTCATCGATCAAGAG
CAGTGGATACCGATAGAGCTTAACGAACTCGCTCACCACTCTGTAGTCAATACACATACGGATATCCACATCATTCTTCTTGAGAACGATCACAATCGGC
GAAGCCCACGCAGATTCTGAGTGCTCGATCAGGCCCGTTTCCAGGAGTTTCTTGATCAGCTCATATACCTTAACTAGCAAATGCGGGGCAATCTGCCTTG
CGCGCTGAGCCACTGGACGCGCATCTCCCACGTCCAAGTCGCAAACTACACCACGAGCAGGGGCTGGAGCCGCGTTTCCATC