Description :
From Genome Similarity Track
Location :
Scaffold_405:3147- 4865
Transcript NameFunction/comments
Aphas_H257_18981PREDICTED: uncharacterized protein LOC101237143, partial

Sequence
1718 bases(100 bases per row)
AGAATAAGGACCATTTAGGACAATGTACTAGGTTTAGGAATTTTATAACAAATAGTGTTTTATAAATAATGGAAGATGGCGGGTATTTTGCAAACATGTT
AAAAAAAGAGTACAATTGCCTTAAAAATTACTTGAATTAGGTGTATTCAGGATTACAAACAACGACGGATTTTAAGGGACACCCGAAGTTTTCAACATGG
TGGGAAAAATTGGCTAATTAGATTCAAATAAGAAAATAATGGGCGATGATTGGTCGAAGGATGGTTTACCGCGGAAACATTTAAAATTCGCGGACATTTG
GAGGCGATGACGAACATCCAGTTACTTCAAAGAATGCCTCCAAAGTGCCGCAACAAAATCAGTCCCCAGGAGAAGCCGAGACGACGCTACACCCAGGCTA
TTAAGCGAGCCATGCTGAGCAGGCTACAATCAGCCTCAACTCGAGACGTGGAGGCGGCGACTGAGATCCCCAAGAGCAACCTGGCACGCTGGGCCAACCA
GACCACCAAGCTCTTCACCTTCGACGGCACGGCAACCTCGATGGCGCTGTCGACCCGAAGAGATCCCCGACACAGCCGCTCTCGAAGCCTTCATGCACAA
GCTCCGTGATGCCGAACGCGCTGTAACGTGCACCCACCTCGTCAACTACCTCAAGCGGTACCATCGCGCGTGGCTCGACGGCTACCTGGCGAACAAGAAT
TGTGGATACCAGTCGCTGCTCAAACTGGTGCAACGATTCTGCCACCGCCATGGCTTTTCACGCCAGAAGCCAGCGAAGTCAAAGAAGACCTTGCTGCCAT
CCGAACCACGTTCGCTGCTGACTACTACAAGGCGTTCACAGGGTTCAGCGGCGACAGCATCATCAACGTCGACGAGACGGGTATGACGTACGACATGCCA
CCTCATGCAATTTGGTCGGTACGCATTGGTACGGCGAAGATTGCGAGTGGCGAAAAGCTCTCGTACCGCATGACAGCTGTGCTGGGCGCCCGTGCGAATG
GCGAGAAGCTCCCCATCCTGTTTATCATCCGTGGCATGCCCGGTGGCGCGATCGAAGCGAATGAGTTTGAGTCGTACCCTCTTGGGCACCACTACGCAGT
GCAAGAGAGGATTCACAAGTCTGGGCCATGTAATTTCGTAAAGTATTGAAGCCACAAGTTCGGGAGCCGACGGTTCTGTTGCTCGACAACTTTGACCCGC
ATGTCAGCAAGGAAGGAATCAAGATCGCCAGCGAGGAGGCCGGTTGTGTTGTTGCTGCCATCCCACCGAATGCCACAAGTACAGTGCAGCCCTTGGACGT
TGGGGTGATGGCCCCATTTAAGCGCCACTTGCGCAGTTTGTGGCTTGAAGAAGATCTCATCGAGGGTAGTGAAAGTGAGGAAGATGTAGATCTCATGACT
GTACCGGCGCAGAAAAAGCGTTTGGTGATGATTCATCGAGCCATTAAGGCATGGGCTCCGTCGCAGATTTTCTAAGGCTATTCCTCAATGATCTTTTCTT
CGGCGAAAACAATCTTGCACTTTGTATGCTATTCGGAAAAAAGTTCGACGCGCCCGGGACTTGAACGGGCTCACTCAAGACACACTACGTGTTTTAACAC
GCGCTATCGCGTCAAACGCTTATCATTGTAGTCGCTTCATCGATCGCGTCAATTTAAAATACGTGATTGTTTGAAATTGTTCAAATTGCAGGCCCTGGAA
TTTGGTTGGCCACCAATC