Description :
From Genome Similarity Track
Location :
Scaffold_321:31466- 37442
Transcript NameFunction/comments
g3773.t1hypothetical protein
g3774.t1hypothetical protein

Sequence
5976 bases(100 bases per row)
GCGACACTCTCGCTCGCGATCGACCTCTCGACGTTCGCCACGATCGCGATCGCGATCACGATCTCCTGTGTCTTCGCAGTCGGCACATATCGGGCGACGG
CTCCGTGGAGGAAGCCGGATGCGCGTTCGCCGTACCTCTCCTGGACTCAGCAGTTCAAGTGATGATGACGAAGCTACACTCGCGGCCGTGTCACGGTCTC
GCGCTTCGGATCGACGACGCCGTCAATCACTGGACCCCTCGGGTCAAGGTTCCCCGCGTGGACCGATCAGTGTCGGATACTCCTCGTCCGGCGACACTGC
TGATCTCCTATCTGACGATCCCGCCGGGGAATCACCTGGCCGATCGCCGGGCGGTTCCCCAGATGACCCAGGAGGTGCTCCCGGTGGCGTCTCTTCGCCA
GACACTTCCGGCAGCGACGGCAGTGTTCCTCGTCGTGCACGTGTGCACCGCAACGTTCTTCTGGGACGTGCTGCCTACGATCGGCTCGCCGCTACTTCGA
TACCCCTGAATGAGTGGATCCCAGGGTATTACTCGCATGCGTATCGCCCAGCAGCTGATGTCGCCCCGTGGGACGTGCGATACGTTCGCCGTGTCTGCGT
CCTGGAGATGGACTTGGATCTCCTTTACCACCATTTCTGTCGCCCCAGGAACTGGTTGATTCCTGTTTGCACTACTCACTCTCGCACTTGGCGGTCGGAT
TTGATTACCACCACCCAAGTGCAGGCGTTGTACGCAACCCGCCCCTGGGAGATCTTCGACACCATGATTGCCCCAATTTCTGTCAGCCTCTGGGGATGGT
TCGCGCCTATGGCTCAGCAGTATCAGGACCTCATCCATGAGCATTCCCAGGCTGTGTGGGAGGCTCTCCATCGCTTCACTGTCAGCGCTGATCGTCGTGC
GCGAGAGACTTACCTCGATACCTTGGCTGGGGAGCGCAAGCAGCGTCAGTCACGTTTCGGTGCTCGGCTGAAGGTCTTTCTCCGCGTCATATTACGTGGG
TTGATAGAGGGACGGTGTGACCTTGACATCTTGTTGGATCCGTTCTTCGTATACCGGCCCAGAACCGGTGAGGAGACGGTATGGTATCCTGGCCACGGCA
TTTCTCCCAGGTTTACCGACTTGATCGCCATCACCCACGAGACCGACATTGCTGAACCATGGCGTATACAACACCGATCGGCCATCCAGGCACATCCAGC
ATATGGAATCGGGCGTCTGGACGGTAAGTTCACCCCCTTGGCCTCTCCGTGATCGTGTAGGTCGAACTTCAAAACTACGTAGGATCACTGTCTTCCTTCA
TCCTATCTCGTCTTCGTGGGGCCGGCCACAGATGATCGCCTTGCTTAATACTCACTTAATCCACATAAACCCCTTCCACCACCGCGTGCAACCGTCTTGC
ACCCGTATCTACCTCTAATCGGCAGCTTTTGCTACTGATTGTCCTCCGCCAACTCGTGTGATTGTACCACTGCGGATAGTGCGATTCTGCTCAAACACAT
ACAGCAGCGCCCCGCAGTTGAGGTCAGCTTCGTCCACCCACGATGGGTCAGCATAGCCCTTCCAGTAGATTTGGTATTCTCGATGGACCCGCCCGGATCT
GGTTTTGCGCCCGGATCGGACATCCACGATCTTCTCGACTTCGAATCCGTTATCACCCAAATCATTCTCCCAGCTATCTTCTGGTAGAAGTGCTTCATCG
AAATCAAAACGATTTTCTTCATGGGTGGTTAGCGTCGTGTTTGGTCGATCAGAAAAACTCCTCACCTTCTTCAGCTTGGTGACGTGCACGATCGGAAACA
GGCGATACTCCGTGTGAGCTACTTCGAGCCGAACAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATGCCACATATGCGCAAGCTTCCGGGC
ATAGTCCTCCTTAACTCGGTCGAGGTAAGCCACACTCGCGTCCCATCTTCAATCTCGTGGGGTCTCACGCCTTCGTTGTGTTGATCGGCTCTAGCTTGTA
TCGCCGCCTTGAGACGTTCATTCACCTCCTTACGCGCTCGCTGGTGTTGCTGTTGAATGTGATACCGCCACCTTCGCGGCTCGTGGTCACACCTCCGCAT
ATTGCCGAGCGGCAACGACGCTTCTAACGTTGATCGTGGGTCCCACCCATGCACGAAATAGAACGGCGTGTCGCCGCGCACCCGATCTTGAGCAGTGTTG
ATCGCGAAGGTCAGCCTCTCGGCGTACTCATCCCAATCCTGCTCATTCGTATCTGCGACGTACATCTTCAAGGCGCGAGTGAGTGTCTGCACCATCCTCT
CTGCCGTGCCATAACCTTGTGGGCGGTACGCCATAATAGCGCGTTGTCTCTGCCCCATTACCCGGTTGAATGCGCGGAAGAAATCAGACATAAAACCGGG
TTCCCGATCATGGCGGATTGCCTCACTGGCCCCAAAACGACGGAAGACACTTTCTTCGTAGTTCTCTGCGATGGTCTGTGCGGTTCGCGAAGCGCTAGCC
TTGGCGATCACATATCCCGAGAACAGATCTACCCACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGAGACGGTATATGGTCCATCGCAATTATC
TGGAATGGGTACGTAGCCTGTACGTTACCTGACGACTCACCCTGTACCACTGGGCGCCCTTTCCCAGTCTCACAATTCAAACATTCGCCCACGAATCTCT
GTACACTCTTGAATAGGCCTCGCCAGTGGAAGTGGGCCTTGATTCGCTGGTACGTACGGCCGATCCCGTGGTGGCCGCCCTCCAAACTGGCATGCTAATG
ATGGAGGAAATCTTGATGCAGGGTTGCGGGGACCACCAGATGCGCCATCGAGTCGCGGTTTTCGTCGGTCCGAGCCATATTCCTGCAATAGAACAACAGA
TCGCCTTCGCCTACGTCGTAGTCTTCGGCGATCTTCGCGCACAGCCTCGCATCTTTGGAGCTAATATCGGCAACGTCTCCTTTCGGGTAAGCCTTCAGGT
CCCCGATCCACTTTTCCTCGTTCTGTGCTCTGGCGATCCGCTCACTTCTCATGCGTTGTACGATCGCCTCTTGCAGCGAAGTTGATACTTGGCGTGTCCT
CCTCGCTGATCGCTTCACGGCGGTCACCTGGTCAATAGAGTCATCGTTTGCCGTTTTCAGCACTTCACCTAATCGGTTGATCGCGATCAGATCGTCGATC
TCCCCTTCGGCCGACACGATCGCCCCTGCTTCTCGCTGTAAGGCAGTGCTTGCAAGCCGATCAGCGCTTTGGTTCCAGTCGCGTTTCACGTGGAGTAGGT
CGTGCGTCGGCCAGCTCTTCAGTTGTCCCATCGCCTTCTCGCGCAACACCTGGAGTCCCGGCGCCTTACAGTCTATCTCCCCTCTCATTTGCCGGATGAT
CAGGTTGGAGTCTCCACAGATGATCACCCACCCCTTGTCTCGGTCAGACAGGAGTTTGAAACCCAGTAGCAGACCGCGGTATTCGGCTTCATTCACCATC
AGAACAACGGCGAATTCCGACGCAGCGGCTACTATGGACCATTCGCGTAACTGCCACATGATCGCGCTGTATGCTCCCGCGCTCCTCTTGACACGTGTCG
AGCCGTCGAAGCTTACGACAAGCAGTCTCTCGTCTAGACCCAATGTGGGTGGAAGCTTCGCGATTGTCTGCTTCGGTTTCTTAACGGGGGCTACGGCGAT
CAAGGCATCGTCCACCTTTGACCGCGGAGTGATACTGGCGGCGATCGCCCCCAGTATTTCGTCTTCTCCTTTGGTGCACTTCCTGATCTCCATCGTCCAT
TCCGACAGTAGAGCGGCTCAACGTCCTAGACGTCCTTGGAAACCCGTTGATCTCAAAAGCCAAGCGAGTGTCGAGTATCTTGACAGTACTTTGATCGATC
GGTTGGTCACGGTGGTGTAACATACGTCCAGGATTCGAAGAAGTGCGAGCACTTCCTTGTCGACCATACCGTAATTCAACTCGTTCGACTTCAACGTACG
GTTCGTGAAAATCACTGGCCAGTACGTTCCTTCGTGCTCCTGCACCAGCGCAGCAGAGATCGCCCACTTGTTCGCATAAATGACGATCACCGGTTGGCGA
TCAGAATCGAAGTGCCGTAAGATCGGGGTAGTTACCAGCTTGGACTTCAGCAGATCGAATGCTGTCTTCGCACGGACCCAGCGGTCATTCGCTTTGTCTG
TTTGATCGGCATTTCCGATGCGATTTATCTCGTGGAAGTCCACTTCACGAAGTTCGTACAAGACCGCCGCATACACCGCGAAGACCTCGATGAACCGACT
ATAATAGTTCAGGCTCCCGAGGAATGACTGCATCGATCGCAACGTTTTCGGGAATGGCAGTCTCTCCAGTGACTCGAGATCTTTCGGCTTGGCCTCCAAC
CCTTCCGAAGACACTCGATGACCAAGGTAATCGACCTTGCGGTATCCCCAAAAAAAAAACCACGCTGATCGACAAGTTCCACCGATCACAGGCGTCAAGC
AGTTTTTCTACTTTCTCTCAAAGAGCCGGCAGTGATCAGGATATCATCGATGTATGATCGACGCCCCAACACTGAAGGTCTCGGTTCATCCTCGGGTTCA
CCATACTTGAACACGTCGATCAGCTTGGAAGGATCAGTGTTTGGACTGATTCGGAAATGTCCATACAGCGCGTTGTCTATCAGTCGTTGGTAGATCTGTG
GGGCATTCTTCAGGCCGAACGGCATACGCGTCCATTCGAAGAGGCCGAACGGCGTGACAAAGGCTGAGATCTTCCGAGCGCGTTCTGTCATTGAAACTAC
CCAGAAGCCACTTGCCATATCCAATGAACAGTACCAGATCGCTTTGTCCAGATCCTCCAAAAGATTGTTAACCAAAGGCATGGGGTACACCATCAGGCGG
GTGAGACTGTTGACCAAACGGTAGTCAATGCACAGCCGAATGTCGACACCGTTCTTCTTGATGATGATCACGATTGGTGATGCCCACGGCGATGTCGAAG
GTTCGATCATCTTTGCCGACAACAGACTTTTGATCAGCTCGGACAACTTCTCTCGGAACTGCGGAGCTACACGTCCGACGCGTTGGGCCACAGGCGTTGC
TCCTCCAACATCGATATCACATACCGCTCCGTTCGCGGCTGGCGGCAGGGCATTTCCTTTGCCAATCAGCAAGTGACGGCGACGCCAGATGATTTGCCGC
AGGCGATCAATCTCTTCTGGGGTATTCGCTTCCGAATCACCCACTTGGATGTCTTCGATCGAGACCTCGTCGGTTGAGCTGGACACCTCGGGAAGGATTG
CCATGTGACCCTCTACGTCTTCAGCAAACAGATCGCCACCTTCGTGTAGGCATACCTCTTCGTCCTCCGCCCGATCAAGATCATTGATCGGTGTCTCCTC
CCTCGGGTCGGCAGCGGCGACCGCTTCGGCAGGCACCTCGGTGGTTATTGTGGCGACTACCGGCTTCGGGGTGCTACGATCGCGTCGCAGAATCTTACGT
GGCGGATCATATCGTGGGCGGTCGACCATTGGCCCTTCCGGTTCGGCGTCGATCTCTTCTTTCTCGATCTGATCGGTGGTGGCTTGAAATGCTAAGTTCT
GCCACTCTGTGTACCTGCGCGACCCGATCAGGACGAAACCTGGTATGCGAGGTACTTGGCCACTGGACAACAACATGGCGACACGTGTATCATCCTGCAG
CACCAACGTTTGATCGCTGATGTTCGTGACCTTCAAGTAGCGCGTCTTTCCCAATCCTGCTACCACGCTCGGTACCCATCGATCGCCTCGAGTAATCCAG
AGTTTCCGATGCTCTGGGGTGATGAACCCCTTGCGGAGTTCAACCGATCGCCCCACGTGGATCACACTGTGTTCCCCGAGTTTGATCTGCTGGAACTTGT
CTCCGAAAAGTTGACGTCGGCCGGCTAGCTGGATCCGCACCTCATCGGGGAGATTGATCGAGCCGTCTGCCAGGTC