Description :
From Genome Similarity Track
Location :
Scaffold_2:31466- 35883
Transcript NameFunction/comments
Phyci_207366conserved hypothetical protein
Phyci_88947ferric reductase, putative

Sequence
4417 bases(100 bases per row)
GCACTCTGCAGCGAAATTGAACCTTTTTCATCGAGCGCGATGCGCACTGCCGGAGAGGAGCGGCGATCCTGTATGGGAGTTGTTGCAGCACTCACGCTCA
CTCCCGTTGAACGCCCATACACTCACGGCCTACGCACACCGAAAAAATGTTTTTCGAGAATTCCCCCCTTGAGACCAACCTATGAGCTGCGCATTCGTTA
TCGACAGGTCTTCACACATGCAAGATCATATGAATCACGTTATTAAACTCATATCTGTTTGTACAGGTATCCATTCTCAAAGGTATTTTTAAAGTGAATT
TTTTTTTTGTTTAGTTAGTCCACCTATACAGCATGCTTCGCGCCGCAGTCGCCGTGTCGACTGGCGATGACGGCCCCCTGGCGCGCTCCATGGTTCGGCG
ATGGCTGCTGTTGCTGCTCGTCGCCCTGGCCTGCATCAGTTGCGTGGGCGCGACTGGTGACGGGCCTCGCACAGCCGTGCGCCTCGTGACCATCCACCCG
CACAACGTCAGCGCCTTCACGGAGGGGCTGGTCTTCGACGACGGTGCGCTCATCGAGTCCACGGGGCTCAGCGGCGCGTCCTTCATCCGCAAGTACAAGC
TATCGGACCTCAACAGCGAGTTCTTCCGGGCGGGGGCCACGCAGAGCGTGCCGTTCCTCCGGGAGTTCCGCTTCGACGATGCCATCTTCGGCGAGGGCGT
GACTGTGCTGGGCGACAAACTGTTCGCGCTGACCTACAAGGCCGAACAGGTGCTGGTGCTGTCACGGGACGACTTCCAGCTGCTCGGCCAGTTCCCGCTC
ACAACATCCACCAAGGAGGGCTGGGGGCTCACCACTGACGGCGAGTTCCTCATCGCCAGCGACGGCTCCGCCAACGTGCTCTTCTTCGACCCGCTCAACG
ACTTCAAGCTGCATCATAGCATCACCGTCCGCAACGACGGCGTACCGGTCACAAATGTGAACGAGCTAGAGTTTGTGGAGGGAGAACTGCTTGCCAATGT
GTGGTTTGAGAACCACATCCTGCGCATTGACATCACGACCGGTGACGTGCTAGAGCAGATCGACCTGAACTGGATACCCAACATGGTGGCTAATATCCAC
ACCAAGGCCATGAAGAAGTCGCCCTTTCTTGCGGATGCTGTGATGAATGGGATCGCTTACGACCCGGTTAGCCGACACGTGTTCGTGACTGGCAAGCTTT
GGGACTCCATGTTCGAGCTCGAGCTCTCGTACCTGAAACCACACGAGCGCTCGCTTCCCCCTTGAACTATCCTGAGTTCGTCAAAGGTACCCGCCATCAT
CAACGTGGCTGTGGTGCCGCGACGAAAGCAAACAATTCTACACGAGAAGAAGAAAACTAGAACAAAGATACGTACATTCGGCAACAGACAACGGCACTAT
GTAAAAAGATACTACTACATCGACTTCAACGACAACATCAGCACGCCTGCTTTCGATCAGCAGGAAAGCTGGCGCGGGCCAACTTGGTTCATCATACGGT
CTACGCAAACTTTTCCGAGTGAAAATCGAAAATAGTCCCGTCAGCCTTCGAGGACGAGTACTTCTTGCACACGTTGGCCAGCACCTCCTCCAACTCGTGG
GGTCCGCAGCAAAACACGCCCACTTCCTCACCAGGGTGCTTAGCTCTAGCATCCGAGAATACCTTGTCCCAGTCCGGCCGACCAAAGTGCGTGAGCTGCT
TTGTGTCCATTCCTGATACGAAATCCTTGCCTGTTTGTTCATGAACGAACTCCTGGAACATCTTGAGCTGTGCAGTGTTTTCTTCGCCACCAAGCACGAC
TGTGCTCAGGTACTGGTGAGTCTCGATCACGTTGTCGCGGTCCATTTGAGAAATCTGCTTCATGGTACCTTCGAACCAGCTCAACGATTCCTGACCGCGG
GTCACCCAGTGGAAGTACAGCTTCTGGATCTGGAACGAGCTCGGGTGACGAACATGATTGCAGTTCAGGCATCGGTTGTCCTCCCAGAGATGAACAACAT
CCTTCAGAATGGAAGCGAAGGGGGTAACACCAATGCCACCGCCGATGCAGATCACAGTCTTGTAACGGTGATAATCTTGCGTCGGGGCACCAACAGGGCC
GTCAAGATATACATCAGGGTACTGCAGATTGCACGCGTGACAGTCCGCAATTACACGAGCCATAGCATCAGTCCAGTCACCGCAGACGCGGATGTGGATG
CTGATGTAGTTGTCACCGGGAGCCGATGAAATCGTGAATGGGTGCCATTCATGGGACGAAATTTGGGGGCAGTTGATGTAGAGGTACATTCCAGGCCTGT
AGACAAAACGACGGGGCTTCTCGATAAAGAGCGCAACAGTGCCGTCAAGCTCCATGGCTTCCATGATGCGCACGGGTGCCGCGAACATCTTGGCGTAGCG
GAAACGACGCTCGATCAAGTAGATCAGGAACGGAGGTGTGATCCAGATGTAGGCCGAGCAGCGAGCAAGCCACGACGTGGCTCCATGGAATGCAAGCACG
ACCAGAAAGGGTCCAAAGAGCATGTGAGAGTACCAGAAGAGGTTGAACTTGCCCTGACGGAACTTGGGGATCGCAGCGAGCGGGAATGAGATACAAGTGA
TCACCAGCAGAATCACACCCGTCCATACCGGTAGTGCTTGCAGCATCGTCGTGAAAGGAGGACGCTCACCGTTCACGAAAGTTGAAACATGGCGTGTCAC
GAAGATTGATCGCTTGATCTCTTCTGGGGTGGCGATCAAGTACAGGTAGATCTCGTTGAAGACGTGAGCGATCGTGTGAATGAGACCAGCGATCAAGAGA
ACGCTGCCCGAGATCTTGTGGAAAGCAATGTGGTCATCAAACGGAATAATTCGCCACAAAAACTTGCTTCGCTTCATCACCTGCGTGATGGAACGGCACA
TGGGCAGCAACACGAAAACGCAGTTGAGCATGGCGACCTGCGCGTTGGCGCGGGCGATACGCAGACCCCATCCAATTGCCGGGTCGACATCGTACATGAA
CCACTTGACCCAGAACGCGATGTTGTTCACAACGAAGTAGAACAACAGCCACCAAATGCGAAGCTTGTTGTCGCTGTACCATTGACCAAACTTGCTCTTG
GGGCGAATAGGTGCCGAGAAAACCGGCTTGGCCTCCTCGAGGTGGTACGAGTCCGTCACGTACGGCTCGAACACGCCGCAAAACTGCTTGAATGTCATCG
CATCGTTTTGAACTCGGGCCTTGCGGAACATAAGCTTCGCCACAGTCTTGAATTCCATGCCCACGACGTCGATCTTAGCACTGGAGAAGTTCGACTCCAG
TAACTGCACGATTTGGTCCTCGACCACATAACCCGTGTTATCAGGGTCAAGCGTATCGAAAATGAAGTGCAGCTTCTGCTCGGCGTTCACTCCAAGTTTC
ATCACAGCGTCGATCAAGATGGCATTACCGTCGATCGTACCATTGCTAGTGGCATACCCATCGAAATCGTTGCCGTCCACTTCGAAGGCATGCGAAAAGG
TCTCGCGCTCGATGTAGCCATCCTTGTCGGTGATGTTTCCCATCACGTCACGAAGCGCTTCAAGCTTCTCCATGGGCGTGAAGGCCTTCTCGTCCATACT
CATGGACACACTGTACTTCTGCTCGAAATTGCAGTCTCCGGGGATTGGCACGGTCACGATGTCGCTTCCAGGAGGTGGGCCGTACATGTCGTCCTTCGGT
GCGGGAGGGGCGATGCGGCATTTCTTATGGGCAGCGCTCGAGACTGATGACACAGTCGAGGCTGACAAGGTCAAACTTTGACGAACCATGTTTGAGCGCA
TCATAGCGTCCACATTGGCACGGCGACGACGTGAGCGACGATTGTTGCCGCTGCCTCTGCAGTTGCCCACTGCGTGGGTCGTGGTCGAGTTCATCGACAT
GAACTTGCTACTGTCCATGAAGTTGGTAGTTGCCGGCCTTCGGAGCGGCGGGTTTTGGTTCATGTTTACCATTGTGCTCGTCATCGGCGTCGACCTGTCC
CCAAAGCGAGGAGCATTGGGCGACGGCGTCGACACGTCGATGAGGGCTTGCGTTTTGGCCGGAGTGATCTTCAGGTCGTCCTTACCGCGCCCGGGTTCTT
TCCTTGAGCGGTCCATAGCTGTTGTCGGAGCCAGGCTGCAAAAAGCAAAATGGAGAGCACGCCGACAGACCCCCACTTGACACTTTCGTGCCGCCTCGCC
AGCGGTGTTTGGCGAAGCGGGGCGCGATGGGGGACTGCAAGGGAAGGCAGCTTGCACGCATGCTCTGTATGTAATTCGGACAACTAGAAACGCGCGCTAC
GACTATCCTCCAAGCAAAAGGCTCTGTCTGGAGAACAGCTCAGGGTTATATGTAAGCCTGCGCTCCGGAAATCCGGCCTCTACTACAGTATCGCTTCACA
CAGACACGCTCGCCACC