Description :
From Genome Similarity Track
Location :
Scaffold_8:314641- 318685
Transcript NameFunction/comments
Physo_250516neutral zinc metallopeptidase, Zn-binding site
Physo_338911Hypothetical protein
Physo_338912glycoside hydrolase, putative

Sequence
4044 bases(100 bases per row)
GTTAGACAAATATCTGATGGCATTATCGTGTACTAGAAGGTGTGTTTAGTGATCTGTAATAAACACATCGATCATCGCACAAAACTGAGCAAGTAGTAAG
CAATTGAAATTTCGAGTGGTGGCTACCATGTATTATCTGATGATTTGCGAGGCACGTTCAGTTGCATCCTAGTTAGTGCCAATTTGTAGCTCTGTACGCT
GCTATCTTTTGGATATACGATTGTCTTCTCCATTCTAAACTGTTGGTCGATGATATATGGCTCAGTACTAAGGTAGAGTGGAGAAATCATGGGTTCCTTT
GTCGCCCCATACAAAGTCCAAGTCGTATCATTTGTAAGGGGTTTTGGTTTATATAGGATTTTGTATGGGAATTAGCTGTCCATAAGTTTTGTCACCTGGG
CAGAACCAGTGATTTGTATGTGAGCTACCTGAAGAAGCGCAAAAGCGCGCGTGTTAGCAGCGTGCAGATCTTTATCAGCGTGTTCTGCAACTCGAGTCCA
AACCGCACCTTAAAACGATAAAAAAGGACGAAGTTACAACCACTTTTGGTGGTGTCCATATCTTTTTGTCGTGGAGTGTACTGTACACAAGGACACTAAA
ATACAACCCAGGACAACAACTCTACAGTAGTAGAGTACGACATCATCATGAATTAGCTTTATTGTGTTGTTTTGCTACATGTACTACTCTAAAGTGATAT
GTAAAAGAGTATAGTAGTAATATTATTTCTACTAGTCCCGCCGCATGTAAGGCCTGCACTAGTAGTTTTTTAAACTGAAACACAGCCCTGTAAGTATCAT
TCTTTTTAGGAAGACGGCTCACTCCACACGATCACGGTGGGGAGGGGGGACTCGACAAGGATGGCGTACGGCAGTGCGACCAAAAGTGCTACCGCTTCTA
CGATGTTGGCATCAACGCGTGGACTGATACTAGCGGGTGCAAGGGTGAGCCGATTGATCTTTCACTGTGGCCCAAACAGGGACTGGCAGGTGGATTCGGA
TTCGACTGGGGCCAGGAGGTAAACCTCGAGAACATGTTGGCGATGCTCGACGAGGACCAACTCACAATTGTCGCCCACGAGATCGGTCACGGCTTCGGGC
TTCCTGACTTCTATGAGGCTACCGACAAGCCCAACGCCAAATAAAAAATTTCAAAATGGCCCAACTGCATCATGATGGCCGGGAGTTCCCCAACTGTCAC
GGACAGTGATGACTGGATGCTGCGTCGTGTCCTGGAGCATCTCAAGTCTCGCTACAAGTTCTAGACGACTGAAATGTCATTTGGACGCTTTGTGAGGTGC
AGTACGGTAGGTGAGAAACGCGTGTTTATTCCTGTTACATTTACTAGTAGTAATACGGTAGTAGCACACATCATTTCTTTATGATGCTATTAGTATTGTA
AACACACCGAACTGCTACTACACTACTACGTAGTACTACATACTAGTACTTCCTGTATCGTTCAAAACACTAGCAAATAGTATATTTCCAATACTACTAC
TTTCTAGTACTAGTAGCACGTAAACAATCCACACGAAGACTCGTTGTACATGCAGCTTACCGAAGAGGGGAAAACAGGTCAATCCTAACAGTTGGTCACG
GGTATGATGGCCAAATAGGTCACACATCAGGACGCTAGGTCACATGACCAAACTTACCAGGTCACACCCCCACGAGATACTTATGATAGAGAAGGTCAGA
TGCGCGCACACGCGCATGGGAATGGTAGGGAGATGCATCCACGGAAGCAGTTTCAAAACCAACCTAAAGCTATTTGCGCTTTTCAAAACGGACAAAGGCC
ACATCGCTAGCCGCCTCTTCAGGAATCATAAACCAAGCTTCCTCAACCAGCACACGGCACTTCCGTCAGCTTCTTCCGTCTCTGCGAGCTCGCTCTACAC
GATGACACGCTGTAGGAACAAAACGACTTCTCCACCGACGATCAACCCATCCTCTCGCCGCTCGAATCGGCAATCACGTCCTCGTTTCTCTCCGCTGACT
CGGCGGAGTATCCGTTCGCGACGTCCGAGCCAGCAAGTCCCCGACGTCCATGAACTGTCCGACAACGGTGTTGTGGGGGCCGATTTGCGTCCGACGCAAG
CGTCGTTAGATCTCCTCGATGCTACAGCGGATACGACTAGCATGCGTGCGCAGGCTTCGTATGCATCTGTAGAGGCGCCTTGCCTGGACGACATGGCAAG
GTCGCGGACGTCAACGACGATGCTACTCGATCCCTCGGGCTCCACAGTGCCCGAGATGCTGTTATCACAACCGGCGGACGGCGGCCACCTGCGGGAAGAA
GCTGGAGGAGCTAATGGTGCCCCAACGGGTTGTACTAACGCGACGGTGGGACGGATCCGGGCGACGTCAAACAAGCGAGATGGACATACGAAGGTGTACT
ACCAGGGTTTCTCGTACGCTCAGGCGAACATTACGAGCGTCAAGATCTCGTATCGTTGTAGCTCGTATCGACAGAAATGCAAGGCGCGATTTGTGTACAT
GGCTGCCACGGCATCGTTCGACTTCAGTGAACTCGTCCCCCACACCTGAAACAATTGGCGGGAACCCGGGTTCCCGCAAATGATACCGACCAAATCGCGA
ATTATTTATTTTATTTTTGGTCTCCATATTGGTACCCTCGGGGCAAGTTAAACCCTCATACCTAAGAGCATCTCCAGCGGTTGGTCTCAAACACGGTTTT
ATCCTAAAAGTAACGCTGTTAAGACTTGGCCGAGACTTAAGGCTTCCACCAGAAGGTCCTATTGCAGGTTTTAGCTCCACCGGGACCTATAGATTGGCTT
TCGAGTCTTAAAATAAGACCACAATCTTAATGCCATCATACAAAACTGAAGAGTCGCCGTATTTAAAAGATTGCACCAAGACTGAATGCAATTTTCACAT
GCGGGAATGGACTTATAAGACTCGCTTTAGAACTCACCGCTGGAAGTAAGTCCGTCTGCGCGGGTCTCAACTGTAAAATTGTGGTCTCAAAGACCCTGTT
ACGACTTAGGATAAGACCCACCGCTGGAGATGCTCTAAGTGCTGTCGATGAAGGACTGCCCTCAAAATATGCCACCGGTACTGAATAGATCCAAATAACA
TACCTTACCATGTCCAAGTTTATCTTTCATGAGCAGGAGGATAGCGATGAGACCGGGAAGCACTGTACCGCTGCACAAGGCAAGCGTCTGGATTTTCGTG
GAGAGACACAGGACGAGGGCGAAGGTGAATTAACATATCGTTCCCCTACTGAGCTTTAGCTGCGTTCTATGTAGGTCATAGACCAACACTTCAATATACA
TGTGTACCGGTAGTTTTAGGGGAACCGGGGTCCCGATGGGTACCCAGGTTCCCGCCAATTGTTTCACCTGTCGATCGGGTGCTGCACTTCAAAGCAGGAC
CGCTCAAGCTGATGGGAGCCCCTGTGAAGATGTGAGCGAGGCTGTACTAGAGGAGGTCGACCAGCTCGCTGTTGAAACGAATATGACCCAACGGGATATC
TGGCTGCACGTTATGGAGAAATTCTACATGCAGTCGGGGCCTCCGGTCCGTGGGGTATCCAAGAACGCGGTTGAAAATCGAGTGAGGTATGCTCGAGGAA
AAGAAACCGGTGGCAACCGCAATCGATCTGTTGAGCTCCCTCCTGAGAGGATCCATGCAGGGATTTTTTCAGTTCCAGTACTCGTGGCACGATGATATGA
AGGCGTAAAACGACTTGGTTTTGGTCGAATTTTGGCATGGGCGCAATCTGCTGCGCTTCGAGAGCCTGTTGTGGTTCCTTGACGGCACGTTTGGGTGTGC
TCCTGCTGGATACAAACAGTGCGTGACAATTATGGTCCACGATCCATCTACCGATCTTTACATCCCTGCAATCTTCACGGTAGCCACCTCCATGCAGAAG
GAGCATTATATCAAGCTGTTGCGCTGTATCGAGGACTGTGTCGGTCGGAAGTTGACTCCTAAGGAAGTCGTGTGTGATTTCGAGGCCGCTCTCATCGGCG
CAATACGAGCATACTTCCCCGACATCCGTATCATCGGATGTTTG