Description :
From Genome Similarity Track
Location :
contig_42:31464- 33217
Transcript NameFunction/comments
g7682.t1hypothetical protein PHYSODRAFT_471542
g7683.t1conserved hypothetical protein

Sequence
1753 bases(100 bases per row)
CCGTCTCTGTGGCGAGGTGGCCTGTCGTCGGTGCATGATAATTCGTGATGCACCATTGCTGAATGATAACGCTACTGTGGCGCCACGGACATTCCAAGTT
GTCAAGACGATGTTCTGCAAGGCTTGCATGGGGAAGGTTCGAGGCAGCGAAGTCAAGTCTATCACCAGCGGCGACAGCCAGGACGAAGGCGTATCGGACG
CCGAGTCCATGAGCTGGTTCCCGGACAAGTCGCGCACTCGAAGCTTTGACAACGATACCAACTTCACAATGACTGGCGGCTCGTCAATCGCATCTCTCTC
GCCTACCGGTGGCAGTTCTGCTCGCTCCGCCCCACCGCAAGATGGCATTGACGAGGATGGCGGCGATGAGGAAAGCAAAAGCCTTCAGAAGTTTTCGAGC
AGCATCAGCTCGGAGGTGCAGTCTGAAACGAAGACCAGCGTGTCGTCTTCACTAGACGATGAGGTTGAAGTGGAGGTGGAGGAGGTCTCGGAGCCCGTTG
TTCCCATGATGATTGACCTGCGTCACCTGCGAACCATGGCTGGAGCGGAGCGTGTGGTTCAAGAGGTCGAGGAGGAGGAACTTCGTACAATGCGCGAGTC
CCTCGCGGCGCTGGACTTCCAGACCGTTCGCCTTGTATCTCCGGTGACTGCAGACGGTGACTCACAAGAAGGGTTTTCCAGCGGCCAACTACCCATTATG
GAGGAAGACGACGTGATCGAGGTGGAGGACGAGCCCCACCAGATCGTTTCTGCCACCCGACAGATCGTGTCGTCTCCTCTCGATGATACGCCGCTGAACG
GGGGATACTAGCGGAGCAGCCCCTGTTCGGGTCCTCTCGATCGATCGGTCAGTGTCTTCAGGAGCAGGAAGTGCTGTTAAAGCGCCTCGTAATGGCGGCG
AACTCATCAGCCGGGTACTGCCCACCCAACGCCCGCGGATAATCGAACCACAAGGAATCAACAACAACTAACGATGGCTTCCCGTGTAGGGTAGCCACGT
ACATCACGTAGTGTTAGGACTGTCGAGTGTATTACCATTTACTGAATCAATGTTTCAGTGGTCTAGTTGCTCGTAAGAAGAGATTGCACCAACACTTTAA
CATTTTCTTGCATCGTCATGGCAAAGAGTGCAAAACCTTCCAGCGGCTTGAGGTCAAGTCAGCAGCAAGAAACGCCATTGCACTTCTACAATCGGCGGCA
AATGCTCCGGTGTTGTAAGTTCCGCCCCGGCGATCACAAAATGACTGGAAGCGTCGAGACAGGACACCGGTGAAGCTTTTGCTCTGGTCGCGGTGCAACC
CGAACTTGCTGCGACCGCCTTACCATCGGCCCCGGTGAACACCATGCGGGTACGAGGATTAAGAAAAAACTTTTACTACGGCGAACGCCACTTCAAGACA
AGTACATGCACGCTCGTCCGTGCAATCGGAATCTATAGTTGATGAACGACGGGCGAACTTCGTGCGTGCGTTGCGACTATCCAAGCAGCTGCACTTGCTC
CGTCGCGACAACAATGCAATAAAGGTTGAGATCTTAAAGCGCTGCAGGCTTATGGCTGTCCTGGGCGGCCAGCATCAATCGCCTCAACAGGTTTTCTTGC
TCGGCGATGCACTGGTCAATGGTGCGCCTTGATTCTATCTTGCCGGAGCTGTCGGGCTGCTGGTGCGCGGATTTGTCGTCGAAGGAGGCTCCAGCGTTGA
TCCGGCGCATCATTTGAGAAGCCGACATTAGGTTTGACATGTCGACGCCCATA