Description :
From Genome Similarity Track
Location :
Scaffold_14:314620- 317843
Transcript NameFunction/comments
Hyaar_Emoy2802633microtubule -associated protein EB1
Hyaar_Emoy2802634microtubule -associated protein EB1
Hyaar_Emoy2802635hypothetical protein

Sequence
3223 bases(100 bases per row)
ATCTGCACCTTGGAATCAGGCGTGGAGACCTAACGGACGGTAGGCTGCAGTCAAGTATGCAATGCTACACCACAGTTCTTTGCTACAAAAGTGGAAGTAA
AAGTGTACTGCACTGGAACCACTACACAAAAGCTGATCATTACTGGATGATTTGAATTGCTCGACTCCTTGGTCGTGAATGCTCATTGAAAGATCAGCAA
TGTTCAGGTCTGCAGGTGATCTGCATGGCAAATAGCACCGATACGAATGCAACCTCGACTCTCGTGGTATCAACGGCATTGTCTACTTACATCCATGTTG
CGTCCCTGTCAACTGAAGAATTATCTGAAACACTAGCACCATTAACCACCTGGCCAAAAGCTGACGTATCCGCACCCATAATGTGCCTTCAACAGGTACA
TTATCTACGATGACAGCACTCTCTTCCATGGACCACATATGTTGACAATCTTCCTCTTTTCACGTATGTGCACGGACCACATATGTCGACAATCTTCCTC
TGTTCACATATGTACACGGATCACAATCAGCCAAATCGACGGATGCTGCAACGACCTTACCATCAATACCAATGCCAGTTGCACAGGTATCTAGCTTCCA
CTGAATTAGCGTACGCGATCATCGCCTTAGCGACCAGAACACCATCCACTGGACCCACAGAGACTCTGTGCCAGTGTTGACCGAAGTCCCAGTACCAACC
AACTGGACAGACCCGTTCATGAGCGAGCCAAAAGTCCGGTTGTAGGTCTCTGATACGGCCCACGACGGAACCTTTATCACATCTGTTGTAACCATCTCAT
GTTGCTCACCTGTAGCAAGCAGCCCATCTCAGATACGCCGTCACAAGCACCGAGAGGGATCCTGGCCGACGTTTACATTTCAAATAGCACACTCTTATTC
ACGAATCCTTACCGGCAACTCATCAGCCTTGCCAATCACTTATTTTTCATGCGTCTCTTTCCTGCTAGCCACGCGTATTGTCTTCAATGCCGCTTACGCA
TAGTCCCTCACATTACAGGGACATAACGAGACACTTCGCCGTGTCATACATAGGTGCGTCTACATTTGCTCGTCCTGCAGTTCACCTGCCACCTGCTCGT
CCTCGGGTCCATCTTCCTCAGTAGCGTACAGTACCTTAAAAACCGCCTGGACCAACGGGTTCGTGTCGCTCTCGTCTGTCGCCTGTAGCATGATCTCCAC
CTCGCGCAGTTTGTGAAAGTAAAAGTCCCGTTCCTTCTCCAAGCTTTCCACCTATCCCCACATGGCCCGTATGAGCTCCCGACACACAAGTCCCCCATGT
AACCAACAACAACACACGTACCATTGCCCGCAACTCGCCGCTCTCTTTCATCAAGTCTTTATTGTTGGCTGCCAGCTCCTCCAGCTCTTTTTCCAACGGC
TCCGTAGCTGCTGCAATCGCAGCTTCCGCATCCACTGCCGACACAGCAGAGCTCGTAGACGATCCAGTGCTTCCAACCGGCCGACGGGATGTCCCCATCG
ACGTCTTCACAGGACGTGCCGCTGTCATCGAAGCAGCCCCCGATGATGCTGTCCGAGCCCCAACTCTTGCCATCGTAGCTGCAGCTGCTGCTGCTCCGAC
TTTTCGACGTATCGGAGCAGCGGCCCCCGACGAGAACGCGGCAGCTGATGCTCTTCCTCCCCCAAACTTGCTTGTAAACTGAGCCCCACCTTTCCCTTTT
TCCCTCTGTGAAACAGGATCATAGGGCTGACCCGACGCATTGCGCTCGTAAAAGGCCTTGAACCACTGCATAAACTCGAGGTTATCCTGGTACTTGCCCC
GCACGAGTCGATCGACTTCCACGTGCTTGTCAATCTTGAGCTGCACGAACGCCTTTTGCAGGACTTTGTAGTTCTGGATGTACTCGTAGTCCTTATTGGC
CGACCAATCGACTTTGCTCATCTGGACTTTGCCTGGGTACATGGCGTCCAGGATCTGACAGGCCACGGCGCCTGTGCACGTTTGCTCGACCTTGGCGAGG
GACACGCCACACAAGGAGTTGATCCAGTCCAAGATCTCCTTGCGCCCGACAAAGTACGTACCGTCCATGAGGCTCATGCTCTGATCTGCAGCCGCCATGA
AGAGAGAGAGAGAGAGAGCCGTGAAGGAAGAGATGATGATGATGAGGTCGGTGCGTCGTAATGAAGGGTTAGAAATACGGTGGATAGAAACGGTAATACC
GGGTGGACGGTTGAAAAAGTTGTAATGGTTAGAAATACGACGAAAGAATTTGTTGATTTAGTAGAGACGAGTTTTGGTGTAAGAATGACCAAGAAAACGA
AAGGTGCGGCGTTGTATGAAGTAGCGCTAATGTGCAGCACGTTGTTGGTAGGTTTTTATTGACGTGTCGTGTGCGTGCTGTTTTGTTGTTGCTGTTGCAG
CATCAAAGACCAAAGGCAATGGTGGCAAGAAGTACGAGGGCAGCAAAAAGTCCCGGAAGATTGGCATGTTCCAGGCACTTCAGAAGCAAAAGAAGTACGT
GCTGGCTGGTAGTACCGTACGCTTGGAATACTACTGTATACTTAACCGAGTAATAACGATTTTATTTTCTTCTTTTTTGTTGCTATTTGATGAGCAGGGC
TGGTGTGGCTGATACGGACAAGAGTGACCCGCACCATATGAAACGGAAAATCAAGCTGGCAAAGCGCCCGACACCTGTCTCGAACGAGTTTCGCAACTTT
GACGAACGTATGGCTGCTACACGTGCAGGAAAAAGGTCAAAGTCGACGGCTGTGGCTTGTTCGTCGTTTGTGGTGGCAGCGCCGACCTTCCAGTTGTAAG
TGACGACGAGCTTGATGATTCGTTGTGAAGCTCAAGATGTGTAGTTGTATCTCTCACTGACATGCTGCTTTTGAAGTAATGCCAACCCTGTGCAGCCAGA
GCTGGTGGCACGTGAAGTCGAAGGCTTTGATGGTTTCATGTCTGCGCTGGAGGCTCCAAAAGACCCGTCGATGGTGCAGTTGAACCAAGTGGCCCGCCCG
GCTAAACCCGTACAGCCCGAATACGGCAGCAGCAATGTATTTGCTGTGTTGGATGAAGAAGATGACGAAGAAAAGCGCATGCCAGCAGCTGTGCAATCTG
CTCCAGCGTTCATGCAGCCAGCGACATTCACTTTTGTGGCAGCCGAGCAGACATTTACGCCGCAGTCTTTACTGCGCTTGAGGACGCAATTGTCAGCAGT
AGAAATGGACCCTGATTTATGAG