Description :
From Genome Similarity Track
Location :
Scaffold_2:31462- 53079
Transcript NameFunction/comments
Phypl_g61hypothetical protein

Sequence
21617 bases(100 bases per row)
TGCCCGTTTAGGATCGACCGCCTGTCCAACAAGCTGGTAGTTCATAACGCCACGAAATTTGATTTCGAGATGAATGCAGTCGTTCGCTGCGTTCTACTAG
TCACAGATGATGCGCCGCATCCACGGTCGATATACACCACTGTTTTTATCCAGCTGGCTGATGTGAATGAGGTACCCGCAATTTCGACGGGCCAACGAGG
ATTTATAAGGGAACATGCATCACAAGGAGAACTCGTTATGACGATCGAAGCGATCGATCCTGATAAAAATCCAGCGTGGTCCTCTCTCCGATTTGGGTTG
CTAAACACAAGTATATTTACAGTTAACTCATTAACAGGGGCTGTCTCGATGCTCTCTCCTGGCGTTCTGGATTTCGAAACTAGTTCGGAGCTGACCCTTC
AGGTTCAAGTGACGGATGGAGGGTTTCTTTCGGCACAAGCCACCGTTTTCGTGTCTGTACTGAACGAAGAGGAGACTCCTCTAGTGGCCGCATTTTATAA
AGTAATTATACCTGAGAATGGCGTGGTTCCTCGgtcgctgcttctcgtcaATGCAACCGACCCCGACAGGATATCCCAGGATCAGTTATCGTTTTCACTG
GTGGAGAATGTGAAAGAGTTTGCTATTGATGGGAGAACCGGGGAGATTATCTTACTAAAACCGCTGGATTATGAATCTGTTCACTCGATAAACCTGACTG
TAAATGTTGCAAAGAGGGGAACAACTTTGAACGTAAATTCGACGGTTTATATGTTCCTTTCAGACGTAAACGAGCCACCCGAGTTGTATGCTGGGACTGG
AATCGGAACATCTGTTGAAGAAAATATGGTAGAGGGCTTGCCGGTTGGCGTTTCCCTGTCTTCCTATATCTGGGATCCGGAGAATAATACGCTGAGCTAC
GTTTTGGAAGCTTCAGAGTATTCGCCATTTTTCACATTGGATGGTTGTGCAGGGCAATTAAGGTCCAAACAACCACTGGATTTCGAAACGATGCCGAGAG
AAGTTAGGCTGACCGTATCGGTTATTGATTCCAGCAAAGCACGACTTCGTTTCTCCGTATCAGTTGCTGTTCATGATGTCAATGAGCCACCAGTATTTGC
TCAAACGCAGTATATACTGACAGTGGAGGAAAATACTGCCAGCGAAACTGTGGTAGGCGTCGTGTCAGCTTCTGATCCAGACGCGGATAATGAGTCACAT
TACATTATCAAGTCTGCtgctgacagcagcacctttAAAATCGACTCAGCAAGAGGTGAGATTTCCGTGTCAGCCACTGCTGTTTTAGACTACGAAATGC
GGTCTTCGTACACGCTACAAGTATGTGCTACTGACAATCTGTTGGAAACCTGCACAATCGTGTTTATCAACGTTCTCGACGTTAATGAGCCACCTTCGTG
TCGGTCAGAAACGCGATTTGTTGTGGAAAACAGTCCAACTGGTGCAACAATCACACCCCCGTTTGAGAGTATCGATGTCGACGTGAAAGACTTGGGGTTA
TATCCCGTTTTTTCTCTCATTGACACTGAAGCAATTGGAGTATTTCGTTTTGATAACGTGTCCATTGTTGTGCAGGGTTTGTCTGTTGATTACGAGGCAC
GAGATATGTACCAATTCCAATTTGCTGCATGTGACACTGCTGGTGCATGTAGTACTTGCAAACTTACCATTTACGTCATGGATATCAATGAACATCCAGT
AGTTTCTAATCAAATAGTTAAAGTGCCAGAAGGTACCAATGCAGCGTTCTGCACGGTTCAAGCCTACGACCCCGATTTGAACCAGACGGGCACTCTATTG
TACGAACTACTTGATCAGTCTCTTGCAGGCGTATTTTCTGTGGAACCTGGAAGTGGAATAGTTAAGGTTGTCGAGCCGGAACGTCTCGATTTTGAAACAG
TACCACTTCATCAAGCGTGGATCAACGTGCGTGTGACTGATAGAGGAGTGCCTCCACTAGCTTCGACTGGACACTTGATTATTCATATTTTGGATATTAA
TGAGGCACCAACCAGCGCTGGTATTATAGATGTGGGGGTTCCAGAAAATGCTGCTGTTGGAACGTTAGTACTCACGTGGATCGTTCAGGACGAAGACTTC
GGCCAGCAATTGACATACCAAGTTGTGAATAATCCATACATGGGCATCCTTAGTTTTCGCGACACGGGTAGCCCTGTCGTGACTTTGGAGGCTTCACTAA
ACTATGAAACCACGACGCAGTTTCAAATTGTACTGCAAGCTTGCGACCCGTACGTCGTGTGTACGTCTACTCTTCTCCGAATTGCAGTTGAGAACAGTAA
TGAGCCGCCCTATTTTCTTCCCTATCTTGAATTTACGGTGGCGAGCCACGCTACTTCGGGAACTGTGATAGGTGTGCTGCAGGCTATGGACCCAGATTAC
GGGGATGTGTTGTCATTCTCTATCCTGTCCTCAGAAAATACTCTGGCGGCAAGTGCCAaagatggcgttggcgtATTTTCTGTCAATCCGCAAACTGGAG
AGCTGAAAGTGGCATCCCCACGAAGTATTGAACAACTTCAAACGAGTTATAATTTCACGCTAACAGCTAAGGTGACTGATTTGAAGCAATTGTCAGCGAC
TACCCGAATTATCGTTGATGTTGTAGCAAACAATACGCCACCGATCTGCCAGAAGGGCCTCTCAGTCTATATGGATGAAAATACTGCTGTTAGTACTCTC
GTAGGATTGCCGTTAGCATCCGTTGTGACGGATGCTGATACTGGAACTACTTTCGCGTTCGCGCTACAACATCCATTCCTGTCTGTAAATCCAAGTACGG
GCCAACTATTTGTAACATGTGAAACCAACCTCGACTTTGAGGGTAGTACACTTAACACGACAACAGCTAGCGTAGTAGTCACTGATGACGGTGCCTATCA
TGACGGGCTTGGTACGCTGAGTACAAGTTGCATCGTATTCATTACAGCAAGGGACGTCAACGAGATCCCCAAGACAACGAATCTTTCCCTTAGGATCTCC
GAAGGTACGTCAAGCGCTGTATTCGCTCCACTTATATTTTGCGCGGGCTTTGACATTTGTTTGTCATCTACAGGATCCAATTCCAACCCATCGCACGTGC
TGCCAACCGAAATATTTACCTTTCCCATCCGTTCGCCTCAACAAGACTGTACGGTGACAAAGAAGATTAGTGGGGGCTATGCAGTAAACGCATCTCAGAA
GACCCTTCCGTTGGGATACGACTCGTTCAGCCAAACTTCAGTTGGAGTCGTGCTTAACTTTGAGGGTGTCCAGTTTCCGGAGGTGATCGATCATATTTCG
CTGGCTCAATTGCGGTTCACGGTTTCGTCTGGAAGAATTGGTCCGTTTTCCCTCCAAATCCGTGTCATTGCCGAGCCCAGCATTTCGTGGGGTTCAAATC
AAGCATTAGAAAACTTTGGCATGCCGGCATTTGTCCAATGGACCGTAGAAAAGGAAGTGGCAACAACGACCATTTGGTCCCCAAGCATTGTGTCGATCCT
CGAGGCGGTAATGCCAGATGTTTCGACCACTAACAGTGTAATGTTTCTTATCACGGGAGGGGGAATAGGAGAGGTAAGCGCCTTCGATCGCGGCGCTTCT
ACTTCTGCTGTTCTTGAAGTCGCTGTAGCTCAAGGTAAGTTTTGTGGATGAGTGCTACAGAATAACTAGCTGCCATTAACTAAGTCACTCATTCTATTAT
CTTGCATTTGAACGTAATCCAGTCTCACGAGTATATCTGGATGGTGGTACGGTCCAATTTTCTGATCCTGACGCCGGCGACAATGTACAGTTTGCAATAA
TGAAAGGGAACCCCCACAATCCTGTGTTCTTTGTTGACAAGGGCACCGGCGAGATCACTACAAATATTGATCTACTGGACTATGAAGTACAAAATGCCTA
TGAGCTTTCGATCTCTGTTACTGATAAGCTGGGTTTGGCCACAGTGTCTACAGTCAATATTGCTATCGTGGACGTGAACGAGCCCCCCGTCGTGAACGAG
AGGATTTGCTATGTCGCAGAAAATGAACCAGTTGGAACACGAGTTTGTGTGATTACTGCTTCCGATCCGGATACCTCAGCACTGGCAACTGGCACGTTGG
TGTACTATTTGGCTCAACCTACTGATATTCAGGACGCTACATTTCAAATCGACTCGAATTCAGGGATGCTGTTTGTAGCAAATTCGACTTTGCTCAACTA
TGAAGTTCGTCAACAGTTGGTCGTAACTGTCTGCGCAAAGGATGGAGGAAATCCATCTTTAAGTGGATGTGGCGCTGTAACAGTATATACTACCGATACC
GATGATGCACCAACAATGATCTCGCCACAAATGTGCGAGATGGACGAGTATTCGTACGGTTTCAATGATCAACAGATGAGCCAACTGGTTGGCGCGGTTG
TGTGCAATCTCACAGTTCTGGACGAAGACTATAGTGGATCAGTGAATGTTTCTTGGAAGAATCACGTCTGGAAGATTATCCAAGCTGATGAGGGCTGTCC
GTTTAATGTTAGTTCTCAAGGTCAAGTCGTGGTGAATAACCCTCGACATGTTAACCATGAGGATCAAAAGAAATGGTCTTTGATGGTTCAAGCAATGGAT
TTGGGAGGCCTATCTAGCCCTCCACAGATAATTGATATCATTATTCGTGATATCAACGAAAAGCCGCAGATGGTCGCAACTACGTTTTACATCGACGAGA
ACTCACGGGCAGGTACCCAGGCAATGGGAAACCTTACTATTTTTGACCCAGACATTCGCAATGATGGCCAGCACGATACTGTAATAGTCAGTTTGATCGG
ACAGATCGACACTTTTAACGTTGTGAACAACAAAGTCGAATTGGTGCATGATGGACTAGACTTTGAAACAAAGTCCTCATATGTGATTTTGGTTGTGGCG
ATCGACGAATCTGGAGCAAAAAGCAACATCCAACAAATGAATATTGGGGTCAATGATGTCAATGAAATCCCGACAATCGATCCCATGCAGGTTTCGATAC
TGGAAAACCAACCTGCTACGACGAAAGTTCTGCCAGCTGTTAAAGCCAGCGATCCTGACGGAGAAAGTGTGCACTTTAGTTTAGTTTCAGAGACCCCAAA
AGGTGCTGGTCAGAGAGCTCCAACCGCATTTGGAATTGATGCGATAACTGGTGTTTTGTTCCAGCAAGTGGACAACCTAGACTACGAACAGACGGATGAG
TACGCTTTGGTTGTGAAGGCGCGAGACAGTACTGGATTATTTTCGACCGCCATTGTCACAGTTACGATTAGTGATGTCAATGAGGCACCTAGCATTCGAG
GCCAGACTGTCAGTATACGCGAAGATGCAATTGTCGGCATTTTAGTCGGACAAGCGTGCACAACAATTTCATCCGATCCCGACTTGAAAAATGGGTACGA
GACACTTACCTATGCACTACAAAGTAGTAACGAAACTACCTTTTCTATAGACTCGAAATCGGGTCAAATTACAACTTCAGGGCGCCTTGACTTTGAAACT
AAGTCTGCCTACAATTTACGCGTGCGTGTTGTGGATTACACAGGATTATTGGATGAAGTTGACTTCGCTGTAAAAATTATCGACGTTAATGAACCACCAA
CTGTTGGTGCATTCAATATTTCCGTATCAGAGAATTTAATACCAGGATCAGCTATCGGAGATCCTATTGTTGGAATTGACCCGGATGTAGGCTCCAAACT
TGAATATGATCTCGTCGGTACAAGTGATCGTGTCACGGCGTGTATCAGAATTAACACATCTACTGGACAGCTTTTTCTGAAAGTCGACTGCTCGCTAGAC
TACGAGTCTTCATCTGGAACTACTGTGTCGGTTGTAGTGCGAGTTTCAGATGGAGAATTCACTGCGTCGACAAAGGGTACTGTTTACATTAACGATGTGA
ACGAATCACCAGTCCTTGTGGAATCCGTACCGACACTCTTCAACGAAAATTCCCCTGACGAAACAGTTGTAACGCTTGTCTTGGTCCAAGATCCCGACAT
AAACGACTACCACAAATTTTGGATCTGTGAGCAAAGCAACCCAACCACCTTTCGAATCCAACCGACTGGTCTGAATACTGCAGAACTCGTTGTTCAAAAT
TCGACGGTGCTGAACTTTGAAAAAACTCCGTCACTTTGGGTCGATGCATGTGTTCAAGATAAAGGTAACTTAACGTCGAGAACGCGGTACAGCATCCAGC
TTGTGAATGTGTTTGAGCCACCTTACTTCGTGCAGGAGATAATTCAGTTCACCGTAGCAGAATCGATTCTCGGTGGGAGCAACATTGGATTGCCGCTGTC
TCGTTTGGTTGTTGACGAAGAGAATTTGAATGCTGTCATCGGATGCTCAGTAGACATGAACATCATGAACAGCACGTGTAGCCGCAGTGTGTCTTTTTCT
CTGGACTCATGTGGCCAAATAACCCTTGCTACTGGCAATTTCGATTACGAAACTATGTCGACGTGCGTGGTTTATATTATGCTTCCTGTTACGGGCCTTT
ACAACGCCAATACCTCATCTTCGCCTCTGGCTGATACCGTGGCCGTAGTTTTAACGGTGACTGATGTTAATGAGCCCCCTACCTTCTCCCAGGAGTTGTA
TCAGTTTGGAGTGGCCGAAGCCACTACCAAAGGTGCTCTTGTTGGGGTTGTGACGGGTACAGATGcggacgctggtgctgttctCTCCTTTCAATTACTA
AGGGCAGAAGTTGGAAATGAAGGAACGTTTATGGTGTCAGCATCGGGCGCACTGATATTAGCAGGTTCGTTGGACTTTGAAACGAAGCAGTCCTACCAAC
TTTCAGTCCGCGTACTTGATGAGCAGGGATCTTACGCTGATGCGAGCGTCATAATCAGCGTTACGGACAGCAACGAACCCCCAGTGTTTCAAGAATCTCA
TTACAGTTTTACTGTAGTGGAAAATGCTCCGGTGCAAGCGGTTATTGGAGACGTTATCGCAATTGACAGCGACACATACCAAAATAAGACTTTAACCTAC
AGCATTGTCAGCGGAAAAGACCTCAGTGTATTTGCAATTTTGTCGATTGCTGGGGATGGGAAAATTGTGGTGAGCGCACGCCAAGTGCTAGATTATGAAC
GACAAGAATCCTATATATTACTAGTGGCAGCGACCGACAGCGGCCCAGGTGGATTGTGCAGTTTTACTACGGTGTCAGTGGACATTATTGATGTCAACGA
AGCTCCGCTAGTGTATTCCCGAACACTCTATATTCCTGAAGATGCAGTCATTACAACTGCGGTATGCACATCCCCAGCCCTCAATGAAACATTCACCGGG
AAACTGTTTGCTTCGGATGCCGATGGCAAAGACAAATTGGTGTTTACAATTGTGGACACGACCGATACGTTTGCTATTGACCCTATCTCCGGTACTGTGT
TATCGAAGCGGTTGCTGAATTTCGAGAGAAAATCAACCTACTCGATCTACATTACAGCAACGGATAGTGGCAACCTGTCGGCAGCATCAATGCTGGATAT
CATCATTTTGGACCGGAATGACGCTCCAATTATCACTTCCACGGCATTTTCACTTGCCGAAAATCGAGCCAGAAACGCTCTTGTTGGGTTTGTTCGTATA
ACGGATGAGGACTacaaccagcagcatttttttgtttttgttgAAGCAACGCTAGTTATGATGGACAACTCGATTGACACGAGTTCAGGCAATAATGCAG
TTTCGATTGGAGCGACGTCTGGTTCCATTCAAGTTGTGAACGAAAGCTGTTTCGATTACGAGGTGGTACGTCAGGTGATAGTAGTGGTAACGGTGAGCGA
CGATGGAAATCCAATTAGGCAAGCCACGGGATCACTGACGCTTGAGTTGACAAACGAAAACGAGGAGTGCGCTTTTGTTCAGTCGATGTTCACATTTCCA
ATATCCGAGAACATGGTTGGCGTGGCTGGCCAAGCCCTTGCAGTTGATCCGGACGCTGACATGTCGCTACCGTGGGGCTCCCTGAGCTACTACATCATCG
ATAGCGAAATGTCAAGTGAAGCAGTGTCAATTTCTAACACTGGTGAAGTTCTAGTAAAAGCTGCTTTAGATTTTGAGACTCAGCACAAGGTCTCATTGAA
GGTGGCTGCAGTTGATGGTGGCGGTATATTTTGTTTGGCTATAGTGCAATTACTGGTAGAAAACATCAACGAACCTCCGGTTATTCAATCCAACCATTTC
TGGGTACCCGAGTCAGTGGACGGGAATTTAGATTGGGTACGCGCAGATGATAGAAGTCCTGCCCGCATATCGTTTTGGGACCCGGAAAATGACTCGATCA
CGGTCTCACAAAATTCATCTGACTATTTTGTCATATCGAAAGAGGGACTGGTTTCTCTGGAGAAACCAGTTGATTATGAAGTAAAATCGTATTACGATCT
TCTAGTTACCGCTGTCGATGTTTATGGGCTCCAGTCGAGCTCAATAGTTCGCGTCGATGTTCTTGACTTGAATGAGCCTCCAGTATTTACGCCGCAGCCA
ACAATGACAATTGCGGAAGATGTTTCAAGAGGAGCTGTCGTGGGGGTTGTGGGTGCTGCGTATGATCCTGACGAATACGATGTAATTTCATACCAACTTG
TAGCAACGATAGATCGCAACGGAAAATCGGTTGATATCTTCATGATACACTCATGTGATGGCGAAATTCGCATGAGCAAGCCCAATGCTCTCGACTACGA
GACAAATGACCTTTTCATTCTTACAGTCAGCGCAACAGATCGGGCGGGTTTGCAGGCGTTCTCTGGACCTATTACAGTAGTAATTTCTGACGTTAATGAG
CCGCCAGTGTGCCGCGACGGAACACTAGCTATCTCAGAAGACGCTACAGCGGACGATCACTTTGGTCCAATTGAGTGGAACGACCCTGATTCGCCCAGCA
GAAACAATATTACAGTGTTTGAAGCCGTCAGCGCTATAGATGAAGTTGGTTATGGAATATTTGAGGTTCGGCAGATTGACGATCAGTACTGGATTGTGTT
GCAGCATTCTGGGGGCCTGAACTATGAATCAGTAAATAGCTTCACTGTGCACATCCGAATTGGCGATAGCTTCGTTTCAAGAGATGAAGCTACCGGAACA
GCGATTGTGTCTTCTTTGTCAACAACGTGCTCAATTACAATTCATGTCCTAGACGTCAACGAGCCACCCATCGCCGCAAGTACGATCAAAAGAGAAATTG
CAGAAAACTCTCCCCTCTTTACTCCTGTGGGATTGCCAATCGAAGCCAGTGATCCGGATGCACTGGACATTCTGCATTTCTCGATTCTCAGTGGCCAAGA
GAATGTGCCATTCACGATTGATTATAATACGGGTCAGATTCGTGTATCGGGAGATTTAGACTACGAAGCCCAATTGGTCTACACGTTTGATGTTGCAGTT
GAGGATACAGCCTTTAACTTGGTTTTAACGCTGGTAGAAATCTCTGTGCTAGACATCAATGAGCGCCCCGAGCTGCCTCGAAATTGTATTGTTCGCGAAG
ATGGCAGCACTGAAAACCGCTACGAGGACAACCAGCACGTGTGCGTTGAAGCCAGAGAAGATCGAGAGGTTGGGTCTGTGTTACGCCACTTTGATGCGCT
TGATCCGGACATCAACCAGCGTCTGTTTTATTCTGTGGGCGAGACGTCACATCCGTTTGTTCGCGTCGTACAAAATGACGATCGAAGCTGTGAACTTGTG
TACAGTCGAGCAATCTTTGACTATGAACGTGCGCATATGCACCGAGTTCAACTAACTGTCACAGATACGGGCAAATTATTTTTGTACGATACGGTGATGG
TTTTCATTTTTGTCCTGGATGTCAACGAACCCccagttcttcttcaagcttCCACGTTCAATCTTGCGATCGCGGAAAATTCTGCAAGTGGACAGCTACT
GGGACAACTTACAGGGATGGACCCTGAAGGAGATCAGTTTATATTTTCATTGAAGGATTCTCGCCCGATCCCGAATACTGTTgacgttgatgaagacggc
CAGCTCTTTACAACAGGAGTTTCACTTGACTACGAAGCGTTGGCAAATATGAATTCTGTTTGGACCGAGCCAATGCTGACGATAAGAGGCTCAATCACTA
CTTTCGACGCGGTTTCAACTCCATTCAACTTTACAATTTCAGTGATAGATGCTCCGGAGCCGCCTTCGTTTGGATCAGAAAAATATGATTTAGCTGTTCA
GGAATTAGCTAATGCGGGTTCTCTCGTTGGTGTACTGCAAGCTATTGACCCAGACTTGAACGATATACATCAATTTAAGTGGGATACGACTGATGCGGAT
ACGAGTATTGCTAGTAACGTGTTCTGGATTGATGCGAAATCTGGAACAATATCGCTTCTTCAAAAGGGGGTTCTTGACGCGGAGTCTGCTTCGACCTACC
GCTTGAAAGCACTAGTGACCGATTCAACTGGTTTGGTGAGTTCTACGACTGTGGTTATATCGATTGTGAACGACAACGAGCCTCCGATTTGTCCTCTTGT
TCAATGCTGGGCTGTTGAAAACTCTGTAGGGCTTTTTAAAGGATTGCCTGGCACTCAAGGGTTTTGTCAAGTGGTAGTACAGGACTTGGATATTGATCAA
AAGCATACGTTCCAGTTGCTATCCACTGCTAATAGTCGTACATTCTTTATCGACTATGGGACTGGGGTAGTGCGCTTTGCATTGGATCAGCAGATATATG
CCAATTTCGAAGTGCAAAGCGTGTATCGCCTTCGCTACCAATCGAACGATATCCCGGATGCTGGCTTATCTTTAGCTTGCAGCAACGACATTGTGATCAC
TATTGTTGATGTGAATGAAGTACCAACAATTCCAGGGAAATTGTCACTAGCTGTAGCGGAGATGAGTGCACTAGGAACAGTGGTGGGCACTATCGATGCA
ATCGATGAAGACATAGGTGATATGCTAAAGTTTACTTTAGAAACCTCGGCTTACTCACCATTTACGCTCGAAGCAGATACGGGCGTTCTCAAGGTAGCTA
ATGCATCCATGATTAACTTTGAAGTTTCGCCGTCGATGGCTATTGATGTGGTGGTGACCGATCGCGAGGGACTTCGAGCTACGGCGACACAACATGTTGC
CGTGATAAACGTAAATGATCCGCCCGTCCTGTTGGCAGCGAACTTCACAGCGAATGAATTTGCGTTATCTAAAGTCAGCGGCTCGTTTGGAGTACGAAGT
TTGGAATTGCTGGGATCTATTCATTGCTTTGACGAAGATATCGGTGATGAGATGTCGTTTGCGCTGTTGAACGAAACGGCCGCTTTCGTGATCGAATCCA
AAAGTGGCCTTTTGTACGCAGAAATCAGATATATTGATTTTGAGATAACGCGTGCGTATGATCTCACTATCCAGTGCTCAGACggacaagcagctgcagt
ttcGACGGTGTGGGTGTTTGTGACAAACGTTAACGAAGCTCCTATCATCACTGGTCAAGTGTATCGTATCAATGAGAACAGTCCAGATGGCACTAGCTTG
GGCTTTATCACTGTTTTTGATGCTGAGCGCAACGATGATAACTTTTTGGCGATCGTTGGTTCAGCAACGCGAACTGCTAACGTGGTGTCCAGGTTACAAG
ATAAAACCCCCGTGTTTTCAGATACTTCGGACTTTGAGTGGATGAATATCCCAGATAATCTCGTCCGTGCTTTTGTCATTGCTACCCCAGCATCAGCGCC
ATTGTCATCTGCTTCGCTGAATTTGGCGAGCTCGGGGGATTTATTTGTACTGGTCGAAGAGGATTCTGATGATATCCCAGACTGGATATCACAAAATGGA
TTCGTGAAAATGGCTGGACAGTTGATAACTGCTCAAAGTAGTACTAGTGCTACCAGTTATGCCATTTTCATCCGTGAAAAATCAGATGGCACCTTCATAG
TCCCTGACACAACTACATCTAGCATGCTGTGCATTTTTGGCGCGTATCCTTCTCCATTGGAGTACTTCATTCACGGATCCAAAAGAGACTGGTTTGACGT
TTCATCGTCTGGGGAATTGCTTCTAGCCACTGCTACACTCGACTATGAAGCTATTAGTGCTTCGGACCAGCCGCTTCAGATCGTTGTGAGCGCCGTAGAC
AGCGACGGTTTAATGGGTGAAGCCACGCTTTCCGTCTTTATAGACGATGTAAATGATACACCAATTATCACTAGCTGCTGCTTTGAAATCGAAGAGAACT
CAGCTGTCGGTACATTGATTGGCGTACTCACGGCAAGTGACCAGGATGCGTCTGATCAAATTTTCTTCGAGCTAGCTTTCCCATCGACGGATATTTCGGT
GACACCAAGTGGTAACCTGTCCGTGCGTAACAGTTCAATTTTTGATTTCGAAAGAAATTCTCTAGTGACAGTCCAGGTGCGTGCGACTGACCGAGGTGGC
CTGTTCAGCGAGCGCGAAATTCAGATTAGCGTCTTGGATGTGAACGAGCCTCCCGTTTTTCAGCAGTCGTTCTACTCGTTTAGTGTACCTGAAAACTCTG
CGTCTGGTTTACCGTTTGGAACGCCGATCCGAGCGGTCGATCCCGATCGCGGGCAGACGGAGAACTTACGCTACGAGCTGGTAAATAAGAATACTGGAGG
GCTACCTTTCAGGCTTGAGAGTTGTTCAGGGCAACTTGCTGTCCAATGGGACAAATTGGACTACGAAGGTACGAATCATTATTCGTTTGGCGTACGCGTT
ATAGACTCCGGTTACCCTGTGGCTCTGGAGGCGCAAGTACAAGTGGTAATCGATATACGTGACGTGAATGAGGCGCCACAGTTTGCTGAGTCTGGGGCTT
TGTTTATACTGGAGAGTGCACCAAGCGGAACATTTATTGGCCAAATTGTTGCTACAGACCCAGATCAAGCGTCGGTGTTGTCTTTCCGTACCAATGCGAG
TGACTACGTTTCCATAACAAATAGTGGACGCCTATATTCGGTACTCTCGTTCGACTACGAAACGATGCCTGCACTATACGTTGTGATCACTGCCGAAGAC
AACGGTGTGTCCTGTGACCCAATGCTCGATACTTCAAATTGCGAGTCCATCTCAGTCTCAACGAATGTTGTGGTATCGGTACGGAATGTCAACGAGCCCC
CGTCCTTAGCGACTGGGAATTTTGCTATTCAAGAAAATCTCTCTCCGGAGTCACTTGTTGGAAAGCCGATCCAGGTCGTTGACATGGATGGAACAGTGGG
AAACAGCTCTGGGTTCTCAATTGTGAGCGGCCTATCAAGCGGGAATGCATCTGAATTTACAGTTCGCAGTGATGGCCAGCTTTTAACACTTGTGACCATG
GATTTCGAGATAAAAGCTGAGTACAAGCTCAAAGTGGCATACTCGGACGGCGAATTCTTGTCCCACCTGAATATCACAGTCAGTGTGCTAGACGAAAATG
AACCGCCTTCGGTTGTTGAAGGCATTTCTGGATCCGTCCAAGAAAATATGGCTGCTGGCACCACAGTTCTGTCTGTGCAGTTTACGGATCCCGATCACAG
CTCAACGAACGCATTCACGCTCGTGGATAGTTATGCGCCATTCAAAATTGACCCGCATACTGGAATATTGCAAACAACTCGCGCACTGGACTATGAAAAG
GACCCTATCGTTTTCAATCTGAACGTGAGAGTCTGTGATACTGTCCAGATAACTGTATGTGGGACTGGCTACGTCACTATTAACGTTACCGATGTTCCTG
AGGCGCCGTCAATGGATGCGGTAACTTGTTCAGTGGTGGAGAACTTAGCTACCGTTCTAACCGAGCAAGGTACAGCTGCGTGTACAGTTATTGCCACTGA
CCCCGATAAAGCTTCGTGCTCTTTCTACGCTATTGTCGATACCAATTCGAATTTTGAGTTGGTGCACGACACAGTTGTGGACGGATTAGCTAAGATCGAG
GTTCTGAAACCGGCGTTGTGCACAACCGGTCGAGTTGGGTTTGCTTGGAAAGCTTCGTCCTTGCCAGATTACGAGGTTCAATCGCAATACGTGCTCAGCA
TCCGAGTCTCGGATGAAACCGTACGAACGACTGGTCTGTTTGTTGATAACCAAGTTACAGTTAACGTCATTAACGCCAACGACTGCCCCACTTTGGCTCC
GTTGTCATTCACAGTGAGAGAGCGGTCGCCGGCTGGTATGCAGATTGGGTATCCACTACCTGGAAAGGACCAAGATGTGTCTGATACTTTAGCGTACGCA
ATCGTGCTAACAAATGCTACTTCTGGTTTGATTGGAATTGACCGGATGACTGGGCAATTGACGGTGGCAAGATCACCTTCGGGCAGCGAGTTAGTATATC
CGGTGCAGTATAATGTGATCATTTCTGTGACGGATAGCAGTACCCAGCGCTGTTCGACCAGTGCCAGCATGAAGATATTCACTACGAAGTCCAACTTTGC
TCCGGTTTGGCTGAACACGTTGCCGACCTCATTCGACATCAATGAAAATTCTGGTACTGGGACGCAAGCTGGAGTTCTACTCTCTAGTTTTGCCCGGGAT
CCTGATAACGACGTGATCCAGTTTACATTGCAATCCAAGACCGACGCGAACTGTGCCGACACCTTCAGTCTGGGTCTGACAAACGGAGCTATTAAACTTC
GTGAAGGGAGCACCTTGGATTATGAAAAGAGACGGACATACATTTGCACTGTCGCGGCATGTGATTCAGCCCGAATGTGCAGTACACAAGACGTTACGGT
TCAAGTAAAGAACATCAACGAAGAGCCGACATTCAGCGATCAGCTGTACACATTTATGGTGAAAGAAAACGAAGCTACCAAGTTCGAGCTTCCACGTTGT
ATCAGTGCCACAGATCCCGATGAAGGCGATGGGTACGCTCTTACCTACGCGATGTCGTGCGCGAATTACACCGATTGTTCACTATTCTCTCTAAAGATTG
AGAAGGACTGCAGCCAGGCGCTATGTGCTAGAATTATTGTCAAGCCTAGTATGAACTATGAGGCTCGACGTCGCTACAGCTTCAATCTACAAGCGAAAGA
CCCTGACCAACTCACAGCTGTCACGACTATTGTTATTGAGGTGGAAGATGTGAACGAGGTGCATTCCTTCGTGAACTTCCTAACAACGAAGTCAGTGCAG
GAGAACACAGCTATCGATTCGGTTGTTTTGCAGGTTAGCACAAAGGACCCCGACATTTACTCCGACTCCTTCAAAATGATACAGTACACGCTAGGTGCGG
TATCTCCACCTGGCCTAGACATTTTCCGAATCAACGCAACAACCGGTGACCTCATTGTGAGCGGCGTCATTGACTTTGAGGCTGTGCAAGCATTTATACT
GACTATCGAAGCTCGTGATTCGAGTGGTGCCAACGCGCTAGTCATTTCCAACGACCTCACCATTTCTGTGGTAAATGCACAAGACACAACCGTGGATGCA
TATGCGCTTGTGGCCGATGGATCTCGTAAATTGGACACAATCGGCGGGGAAAAGTTCGTCTTGTCGGGCTCAAATATCGGTTTCAAGCAGCGTGGGGATG
GTTCTGTGGTGATTAAGCAACTACTTGTGCAGTATGGGGCTTATGGAACTACTTCGCCTTACAGCGCAACAGACTGCACCCTAGTCAACGGAAACACTGG
CGTTGAGTGCACAACAGCTCCAGGCGTTGGAGCCAATCTCTACTGGAATATTACTTTGGTCATTAGCGTTCCCAATATTGGTGACACGACATTCCAGGCG
ACATCTTCAGTTCCGTTAACATCTTATGGATCGCCAGTTGTTAACTCTGTGGTGTGCACTGTTGCGTTCCCTACTAGCGGTAGTACTGTGGAAAACATTT
TCGTTTATGGTGATAATCTGGGGTCTGTACACTTGACGAGTTCAGACGCACAGCCTGCTGTTTTGTATGGCTCCGAATTTGAGGCGCAAAACTGTCAGCT
ACACGCATCTAGCAGTCACACTGCACCTTCCCCCCAATACGTTGCGTGCCGTAGTACTCTTGGAACTGGCCAAAATCTTCCCTTTACAGTGGTGGTTCGC
GGCCAGGCAAGCGCGACGTTCTCTACCAGCTGTCATTATGCTTCGCCTGTCATCACTGCTGTGGTTGTGTCTGACGGAATGCAAACTCTTGGAAGTGACG
CGATTCTGGTGAGCGGAACTGGATTTGGATGTCAGGGTTGTGCCAACATCACAGTACGGTACACAAACGACCTTCATatgttcgagctggacgactgCAA
GGTTGTTGTTGACCACGTTCAGTTAGCTTGTTTATCTCGAcctggtgcaggaggtgaCTTCCGATGGCAAGTTTCCGTCGATAGCCAGCACAGTGTGTTG
ACTCGCAAAATGTCTACCTCTTACGACCTGCCCGAAGTCAGGGAAGTAATGGGCTTTAAGGACGTTCTGACTGTAGGAGGAACAgtcttccagcttcttg
gtgacAACTTTGGTCCTGACACTGCTATCTTCGTGGATCCCGTCGTCGAATATTCGTTCGACAATGTGACTGTCCTTCGAGCCGTCAACTGCAAGCGGAA
ATACACGGACCCAAAGAACCACAACCTGATTCAGTGTGTCTCCGTTGCTGGCAGTGGGTCCTTCCACTCCTGGAGGGTTACTATTGAAGGCCAAACCTCG
CTTTGGACAACTCAAAATACGTCGTACGCAGGGCCGATCGTGAATAAAGTCTTCCGTCCGGATGGAGAGACAGAAATTAAGACGAGTGGGGACCAGCAGG
TGGTTATCACAGGTAAGAACTTCGGCACTATTAACGAGTCTGTCGTTACCAGTGTAACGTACGGTGTCAACGGGGATGAATTCGCTGCGAAGGACTGTGC
TATCGTGATTGACCACGAACGCATCACATGCACGACTGCACCTGGAGTGGGCAATCGCTTAGCCTGGATCGTTACGATTGATGGTCTGACTAGTGCGACG
CCCACGATTAGTTATGCGAAGCCATACATCACCTCGATTGAAGGGGAGGGGGCAGTGAATGCTCTCGTTCGTGGCGGACAGAGCCTAATTCTTCGCGGTG
GTAATTTTGGGCCGGGTGGTGTGGCAATCGACAGAATTTCGTATGGTTCTTCCGGGCGTGATTATCAAGTAATGGAAGTAGTCGAGCACAACGATTCTAC
AATAGTTTGCATGACGGTGCCTGGTGTCGGCGCGAATCTTTCGTGGGTTATGTCAGTTGGCGACCAAGAATCGAGTTTGTCGACCGTCACGAGCTCCTAT
GCACCTCCTGCAGTGACATCGTACTACCCAACGGTGGCGCTCACGGATGGTTCAAGTCAAGTTACTATCATTGGAGAAAACCTAGGTGCAAATGTGACGT
TTGCAGCATCACGTGTGATGTTCTCACCACCTCAAGCAAGTTTATCGAGCTATCGCATTCCTATTGTTGCTTTTGGGGATTTTGGTGACAGTAACAGCAG
TGAATATGTCGTTGTTCGGATCCCGGTGGGCTATGGAAGCCGTGCCTTGTTGCAGATCTTGGTTGGTACTTCAAGTGTGCAAAAGAGTGCTTCGTTGGCG
ATTACCTACGGCCCTCCTATGGTCGATTCAGTGTATACTGATGAAGGCCCCAGCGAGTGTCTGCCTTCGTGCATACAACTTACGGTAACGGGCACCAACT
TTTACACCACTGGCCGTGTGCTTGTGTCAAAGTACCCCATCACGGCGAGCAATCTGGAAACTGCAAGTTATGAATCCTCGGTCGAATTTTCATCTTGGTC
TCACTACACTATTACCATACTTAAGTACATTGGCCGGCTTGGATATGTGACCGTTCTGATAGGCAGAGAGAAATTGCTGAGTAACTCTGCAGCATTCAGC
TGGGATGACCCATCTATTCTGGACTGGAACACGTATCTCCCAACATGTAGAGTGCATGCTTGCACAACGAGTTACCGACTGGATGGGAGCACGAACCTTT
ACCGCACAGTAGCAACAACCCCGGTTATTTCCGATGTCTTTAGCTATGAATCTGCCACAAATGGTGGAGCTACGCTGAAACTACACGCAAAGTATGTCGG
TCGCAGTCCTCGAGTAACAATTGGTGGTATCGAGTGTGCAAGTATCGTGCTCAGCTCCGTTTCCATACCGTCAAATGTACTTTTATCAGGTGATGTAACA
GGAGTCAGCAATATTCGTGAGATTTCCTGCACAGTACCGAGCGGCCAAGGAATGATGCTTGAAGTTCTTGTGATTCGTGGCTCAACGTTGAGCAGTCCGA
GGTATTTTAGTTATTCCTCGCCTAGTGTGGATTGGACCGGAAGTTTTGCTACGTCTGCACCTACCACTGGCAAAGTGGTGACCCTCACAGGGTCGGATTT
TGGCACTGCACCGATCATTTCAATAGTTGGAAGCTCTAGCTGGACTGTTTTACTTGATATTTCAGCATTCAATCACTCGCAAGCTACAATTTCTATTCCG
TCTGGAGAAGGTCAGAATTACACCATAAAATTGCAAGCTGGAAATCAAGAAGACACGACAGCATTCAATTACAATGCTCCCGTAATTCACAACATTTCTG
TTGAAGATGCCACCACTGCCGGCGGATCTACAATGACCATTCAGGGCGAGAATTTTGGAACAAGTGAGCTTTCAAACGCCCACACAGTCTCGATTGGCGA
AACCTTTTCGTGCACAATTGAGAGCGTCGATCATGAGTTGATTAAGTGCACGACAAGTGAGGGGCAAGGAAGTGGGCACGAGGTGGTCGTCTTGGTGAGT
GAACAATCAAACGTAGACCGAACGCACATATTCAGCTACGATCCTCCCATTATCTACAACATCAGTAAAAGCGATGGTCCAACGTCGGGGTATACTTGCA
GCTGTATAGATCCGGATCAACCCTGTGCTACCCTCGAAGCACCTGTCGAGTGTCGTTACCTCGAGGCAAGTTCTACCAGCACCTCTCTCGATAGCTATTG
CGTGCAAACGGTGCTCAATGGGGACTCCCAGAGTGTGACTTTCACGGCGGTGGGGGATGTGTATTCCAGCAACAAACCTGTGTATACGAGTGATGGGAAC
TTAGATGTGCAGCTCCTGTACGCGGGTGGATCTTGGCAGCTGCTTCAAAACGATGAGAGCATTTATCGTGCTAGCACGTCCACAGTGAGCCCACCACCGA
CAGGGTGGCTCGACGTGACAGTGGATCCGCCGGTTAGTCTGGCGACAATGAAAGTCTACCCAGGTTCTTGTTCAAAGgcagcttcacgcgcttGTCCCGC
AGGCACGGAGTTGTGTGAGCGTGTAGCGATCACACTTGCCGGCAAGAACTTCGGTGTCCAGTCGCTCGATTGGCATCTCGAGTTGCTCAGCAGAGATGGA
TCGATGGAAACAGTGAGTATGAATGACGACGATATTGTGTACTTCAGCCATTCCAACATCAAATTTAACTTGCCGTCGGGACAAGGAGGTTCGCGAGTCG
TTAACCTTACTGTTTCCGAGCTTCAACTGGTCAACACGTCAATTGAGTTTGGCTATCAGACCCCCGAGCTGATCGGATATGAGACCAGCACAAGTAACTT
ATCCACTTGCGGTGGCTACACGATGACTCTATATGGGAAAAACTTTGGGTCAACCCGAAGTAAAGTACTCATTGGTGGTCGGGATGCACGTGTTGATGGA
CAAAGTTCTCATGTAAGGGCCTGTGGCTCGAACACGTGCGAATACTCGACGAGTGGCCCCTGCATCGACACCGACACTCTTGTCTGCTACCCGTCGTTTT
ATGTTGTTAGTCCTACCTTCAGCTTCCTCGAGCTTTGTGACGACCCCAGGGGGACGCAAATGATGTGTGAGACTGCCGATCCTGCTCCAGATTTGTCTGA
AGATTTCACCAGTCACTCAGATTTTGTAATCGTAACAACAGTGCCAACTGGGTATGGAGCTGATGTGGAGGTCTACGTTATCGTTGACGACCAGCCTAGC
AATGCATTGACGTTCTCGTACAACCAGCCAGTGGTGACAACTCAAATGCCAAATCAACCGGATGCAAATGGAGCAAACGCTATCATAATTAAGGGTACCG
ACTTCGGTTGTTTCCCGAATGATGCTATCAGCATTTCATTCGTCTCCACTGACACGGTGCAGTCGATCTCGCGAAAATTAAGTACTTTAAGTATCTCCGA
ATTACGCACCATTTCAAGTATTTTTGAAGATGAATCGGACCGACGGCTAGATGATACCACGACTTCATCCAGCTCAACGAACAGTAGCGAGAACTCCACT
GGGACTGTTGTCTGGACGAGCGCATCGGAATTGGTGTGGTATCCACCCAAAACGAAGGCAGGTATCACGAGCATTATTCTGTCCGTTGGTGGTAACGTGA
TGTCTTCTACAAGCCAGACACAGCTCAAGTTCCAATGTAGCCCAGGATCCTACCGGACCTCCACGGAATTCTGCGATGAATGTCCTGAGGGCGCTACGTG
TGCTGGTGGGGACGAGATGCCGCTGGCAAAACCTGGTTACTGGCGTGAAGGTGAAGTTGTCCTTGCATGTGACCCCATGTACGCATGTTTGGGGGCCAAC
AAGTGCGCAGTGGGCTACACAGACATTAGGTGCGGGGAGTGCGAGACCAACTACCACAAGCTCAATTCGGAGTGTAACCTGTGCCCCGCCAACAAATGGG
GATCTGTCGCGATCGTGGTTATCTGCATCGGTGTGGCATCCATTGTGAGCTACCTTCTGACCCGAAGAGGGGTGAGTCTCGGATTGCTATCCATCGGTAT
TGACTACTTCCAGACTCTCTCCATATTTGGCAACGCACGGATTTCGTGGCCGACGTCGCTCATTAACCTGTTTGCAACACTGTCTGCCTTCAATCTTAAT
CTGGAATTGATTGCACCCGAGTGCTTCTCCTTCCAAGTATCGTACGTGAAAAAATGGTTTATCATCGAACTGTTCCCATTAGTTATGGTGGCCATCTCGC
TGGGAATTTTTGTGGCGCTTTACGTTTACAAGCGCTTCATCAAGAGACGACGCACGCGACTAACATCGCATCTGCCGCAGCTGTTCGGCTCAACGCTCGT
GATGATGTATTACCTCTTCCTGTACCTCACGCGGACGACCTTGGACGTGTTCAACTGCGTTGGAGCCATACCGTCGGATGGGAAGCTGTACATGGTGGCC
ATCTACACGCAGTGCTTTAAACCGGGTGGAGTTCATATGCAGCTCTTCCCGTTTGCTGTTCTGGCCTTTGTGGTGTACTCACTGGGCTATCCACTATTTG
TGTTGCTAACACTTTCTCGTAATCGTGCATTGGTTATGGAGGACCAACTCTTGAGGGCGATGCAGCGTGGAACGAGTCGGCGAACAAATCCAAACTGCTG
GGTCTTCCGCAAGAAGTTCTCCAAGCTTTACTATCAATTCAAACCCGGATTCTGGTACTGGATGGTGCTCATTATCCTGCGAAAGTTTTTGTTGGCGGGT
ATCGGGCTGCTCTTCCGTCAAGATCCGGTGTTCCAACTGGCTACAGCGACGTTTGTATTGTTCGTGAACTACGCGCTGCAAGTGCGATGTCGCCCGTACA
TGAGCGCGTACGAGACACAGAGAGTGCTGGCCGACTATGCTAAGCGGGTGCTGCTAGAAACTCGCCGCGCTAAGGCTAAAGGGGAAACGTACATTCAGCC
AGCTCATCTTCGTCTCG