Description :
From Genome Similarity Track
Location :
Scaffold_1528:3145- 8927
Transcript NameFunction/comments
Phyta_totarag13195hypothetical protein
Phyta_totarag13196hypothetical protein

Sequence
5782 bases(100 bases per row)
CAAGGCCAGATCTCTCTATGCCGAATGCTTAACAGTGAACGAGGCGGAGTACAACGGCCTTCTGTTGTGTCTTGATCTATTGGATGGGATGGAATACCAA
CGTCTCGTGATCTGTGGAGAGTCAAATCTGGTGATCCGTCAAGTTAGAGGTGAAATCGACTGTAAGGCGCCTGGGCTGAAGTTCCTGAAGCAAAGGGCAC
TGGATCGGCTACGGGCTTGGCCCAACCATGAACTGGTACATGCGAAGCGGGAGTGGACTAGCATCGCTGACAGCCTGGCTAGTGCAGCACTCCAGCGAGG
AGAAGGGGTCGAGGTGACGAAGGAGTCTAATAGACAGAACCTGGTTACACTAAACCGACTAGACGAAATTTTGGTTGTCCGATCAGAGGACCTAGTAGGG
AATATCTCGCCGGTCATCACCAGATCTCGAAATCGGCCCAGATCCAACCCCGAGGTATTGAGAGAGGAACTCGTGCGAGATCTCAGGATCGACCGGATCC
GTAGAGcacaggacgaggaggcgtAGATCTCTGGGCTGAAGAGATATTTAGCCGGAGATGTACGCGGTCTGGATCAAGCGGAAGCTAGATCCTACAGTGG
TATTGCTATGGATtacgaggtggacgaccagGATCTACTATTTTactgcccccccccctcctaAAAGATCGAACGCAGATCGGACTGGATTGATGAGGCT
TGTGGCCCCAGAAACGCCCCATCAGGATATTCTACACCGCTATCACGCGAGTATCGAAGGAGGTCATCAAGGGATAGGGCGTACCTACTTGCGCATTCGG
GATCATTTCCATTGGAGAGGCCTCTACCGGAGTGTGCAGCAGTATGTGGGGAGTTGCATCGATTGTGAGACGTGAAAAGGGAAACCGACGATCCAAGGTG
AGTCGCCTGGAAATATCCAAGCGACCTACCCGTTCCAGATCATAGCCATGGATCATATACCTTCGCTGCCTAAATCATACAAAGGTAAtacggagctgct
gctctgggtAGATCTATTTACAGGGTATGTAATTGCTAAAGCTAGCGCGTCCAGGACGGCTCAGACAATGGCCGAATCTTATGAGGAATGTGTTTTCCGT
TGGTTCGGTGCCAGTGAGGAGGTCCGGCATGATCGGGAGTCAGGAGTCATGTCCGAATTTTTTCGCGCGTTCAACAGGATCTTGGGACAACGGCAGCGTG
CCACAATGGCCTATCGACCCCAGGCAAACGGAACAGCCGAACGTATGGTGCAAACGTTAACTCGTGCATTATAGATGTATGTACAAGATCTAGAGCAGCA
AGACTGGGACGAATATGCCGAACAATTGACGTTCGCGATCAACACGGCCCAACACCGGATCCGAGGTGACACCCCAATTTACCTGGTACACGGATGGGAC
CTCGGATCTACGTTGGAGGCCACGATCCCAGTAGGCAGCACTCGACGACAGGATCGAGATCCACGAAGATGGCGGTACCAGATCCAAAAGTATTACCGGC
AGGCGCGAGGACAGGCCAATGAGAAGTTACGCGAAGCCATCTCCGATCGGGCAGATCAACACAACGAGAGAGCTCAACCCCACCAGATCGAGGCGGGATC
GCAAGTCTGGCTATATCTAGATCGGGTCAAGGAAGGATACCCACGTACGCTGGCGCACCTGTGGCACGGTCCGTTACGAGTGACCGATCGGACCAATGTC
TTCACCATGAAATTGGAGATCGCAGGTTCTGGATATCGTCTATTTCCTATAGTACACGTATCTAAGCTCAAGCTGGTCAAAGCGTTTCCAGATCGGCCGA
AGATCTGACTCAACGTCGAAGACGGAGACTGGCTAGATCTCGATGAAGCTCTGCTGCCAGAAGACAGCTGGATCCAGGATCTAGAGGACGATGAATACga
agtggaggagatcgtcgaTATGAGGACCGGCCGAAAGACCAGATATGGTCGGATCCTCCGAGAGTTCTTGATGAAATGGCGGGGATATGAAGATCGGAGC
TGGGTGGACGAAACCGATCTTAACTGTGGTGATCTATTATATGAGCTTTTACGAGGTCGCACCAACCGCTACAGGTTCGAGGTAATGCAGTCTCACGAGG
AGTAGCCGGGCTGTGACCGATCAGGATGAGTTGGTCGTCCTGATCGGAAGAGTGAAGAAGGATCTGCGAGAAGGTCGCAGATCGGAGGAAAGGGATATGC
atatatacatgtagactcAACATGGGAGACCAGACCTTCAAAATCAGATCGAGATATTAAGGGAAGCTATCAAGTTACGCTACGGTCACATTACTAGAGT
CAGGACCGGGAGGCGGGCGAAACCCAGTGGCAGATCCAGACCGAAGGGGAAGAAGTTACTCAAGGGGAGGGCCGTCCCGGAGCTCTGAGACACGTTGAAG
AACTTGCCAGGCAATCGCGAAATCCGGCGAGATGGGTGAAGATCCGGAGTGTCCCGGTAGTGGTTACGCCACGGATCGGCATCGTTACACTCATCCAGAG
CCTCCAAGAGATCCGTGGGCTCGACCCGGTTCAGAGTCGGATCCGCCAAGTTGGCCGACCGCGACACAATACCGGGGTACTACATCACTGACTCCGTCCG
AcggaggaagtggaggatGAAGGGTCCAATAACACGTCCAGATCACACCAGTTCTCCCGCATGGCGGTGATCAGGACCCAGACCAAGCGTTTTCACGCGC
TCCCTGCGTGGGAACGACGGTTTTTCTGTTCCTTCCAGAAATAGAGAAGCCACGGGTCCGAGTCTCATAGCACCGTGGGGATGGGGAAGAAGTGGGTAGA
CTCCCAAAAGGCTTGTAGGAGACCCGCCTCCAACGTCTGGTATTCTTCCACAAAAAGACCAaaacgcccccccccccacgtCGCGGCGGAACGAGACCGG
ATCTCAGGAATTCTCCAAAACCTCCCAAGGTTTGGAGCCATATAAAGCCTCCACATGAGCCCGGGTGACCAGATCGGGGTGATAGTGGGTCGCAGGCGGA
GTTGGCTCGTGTGGACGGCGGGCAGGATACAACCATCCTGCCTCCACAGGTAGAGCGGGGAAGATGGCGGCGGTTGTCAGGCTGCAGATTGCCAGCCGGT
TGACCGAGGCAGGGATCCACGGGGCTACCTGAGCAGCAGTCAGGGTGTGCGGACGAGCGTAACCCTGACTACAGGTGCTGCTAGGGCCAAACGGAGCCGC
CGGAGGATTCAGGTTGCGCCCCCCACTCGTGGTAGATGTGGCCGCAAGACTAGTGGTCCTGGCAGGTGTGCGGTGGGGGGGGCAGGCTTAGCGGAAGAGG
GAGCAAGTCTAGACGGTAAAGGTGCTGAGGGGGTTTGCCTCGACCCGCCGCTAGATCTGGTCACTTCCAGCGGAGCCTCAGCACTACCCCCGGGGGTAGA
CTAGTGAGCCCGTCGTGCCTGTGAACGGGACTGTGACAGGGCCATCAGTGTCTGCTCTtccagttcctcctcctcgtcggaAGATAGTGGAGCAGAGCCA
GGTCCATGGGTGCTGGGATCTGGGGTGGATCCACCTCCAGATCCTCTGTCATCATCACTTGGACCTGAGAGATGGTGAGGTCCGTCGGACTCCGGATCAT
CAGATTCAGAGCTAGATCCGGAGTCATCGGGACCTCCATCTCTGCCCGTCGGGGGTTGAGCGGGAGAAGCCGCCCCACCGGATGTCGTTGATCTCCAACG
GGATCAGGATCAACAGGAGGAACGGACCCGTGAATGGGATCCGGAGATCCACGACAGGTTCCGCCCGATCCAGCGGTACTGGCGACTGTTCGGCCGAAGA
GGCGGGATCCAGGCAGCGGAGCTTGCGATGAGACGGGGTAGTGGGGACCGGAGAGGAAGAACGACTTCAGCGATACTTGGGCGGTTTGGGAGCCGGAGCG
CTCACCGGGACCGAAGCCCCACTCGCGTGCTGATCCGGAGCCAGATCCCGCTGAGATCTGTCTCCGAGGTCTCCAGAAGGGGCGTCCGAAACCGACGGAG
GTACATCTGTAACACCTCCAGAAGCTCCCGCCGGAGGAATTGCTCCGTTTACCACCGAAGCTACAACAGCCAGTCGCTGCAAGGCGGCCGAATGGACGGC
AGACGCCGCCTGCAACTTCTGCTACAGGACTTCGCGCTCTCGCACCATCTGGGTACGATCGCGCTCGGCGGAGAATAGATCCTCACGCAGCCCGGAGGAA
ATCTGACGGGCGTCGGTCAGTTTAGCTCCTGTAGGCAAGTCATGGGTTAGCTCCAGATCAACGAGCAAATCCATGACAAGAAACTCCAGATCAAGTAACT
TACGAAGATCGGAGACCTCCTGGGCTTCGGATCGGGCTGCGTCGCGCTGTTTGATCCCCTCCGCGAGGGACTCTAGCGCTTGGCCAAGATCCCGGTCCAG
ATCCGCGGCCCTGGCCGAATGTAGATCACGGCCCTTGGTGGCCTGGGCAAGAAGTCTCTGGGCCACATCCCGTTCCTGACAGACCTTACCATGTGCTTGG
TCAGAGCCTGGATCTCTTCACGCGCCTGATCTCGCTCCTTCATTACTGCCACCAAGTGGGGTGTGGATGACAAAGGAGCGACATCGGACGCCGGGGGATC
AGACCGGGGAAGTCCGGCGGAAGTTGTGGAATGAGTCGATGGATCTACCGCCGGAGGAACGGCCGAAGCCGTACATCCAGACTGGAGATCCACGATCTCA
GCCTCCGCCCGTTGGAGAGCGAGCCGCATCCGATCTAGGCTAACCTTCGACGCCTGAAGCAAAGCCTGCGCGTCGTCTCGTGCCCGCTCCGCCGCGTAGA
GCtgatcttggagctggaagtagTCTTGGCTCGAGATCCGCAGCATAGCGGACAGATACTCGTGATCTGAGGCCAGCTCGGTTCGTCGTTGTTCCGAGTC
TCGGAGTTGCTGCGTGAGACCGTCGATCTCAGCATCCTGACGGTAAACTCGGTCTTGCCACTCTTGCACCGCGGAACTATTGTCAGACGCGTCCTTGAGC
GCGTCGACCTGACCCCGGAGATCTTGTATTTCCCCCAGCTGATCATCATGAGCACGAGTTAGATCCCAGTGGTCTTGAGTGAGGCGGAGCAGGACGTGGT
TATTCTGCTCACGGGCGCGGATGGCATCATCGCGGGCTATCCGCATGGTCAATACGGCACGCTCCAGCTGGGTGATGCGCGACACCAGACGGTTGATGTG
CCACAACAACTTCTGTATGGAAGAACTGGCGAGCTTGCCCGACGACATCACAGGAGGCTGGGGAGTTTTAGGTGGCTGATCTGGGGGTGACCCGACGCCG
CCGgcagatgaagctgtgcCGGCCTGCGACATCGGGAGGTCGGAGAAGAGTTGAAGTATACGCGCAGCGATACTGTTGGGCGGTAACAGCTGCACGCAGG
AGGCGGTTGTGGTGAAGTACTTTCTGAAGTGacatgcagaagatggaTGGGAAACGAAACGAGTCACTAACTCGGATTAGTGACACACCGAGTAAGAGCT
GTAGACGTGACCAGCGACTTTGGCGAAATGGCTACAGAGACGGGGAGTTAGCTCGAAAGGAGGAATCTACGTAGACCAGGCTTAGTGGATCTGACATACA
GCGTGATCCAGATCCGAGATCCAGGTAgatctgatctacatcgtgGATCCAGGTCCGAGATCCAGGTAgatctgatctacatcgtgGATCCAGGTCCGAG
ATCCAGGTAgatctgatctacatcgtgGATCCAGGTCCGAGATCCAGGTAgatctgatctacatcgtgGATCCAGGTCCGAG