Description :
From Genome Similarity Track
Location :
Scaffold_1320:3145- 4175
Sequence
1030 bases(100 bases per row)
AGCTGCTAGTGCTGGAGCAGGCAGCAGCTTCGGCTGCATGCTCCCAGGTCATGAAGCCCCGCATGAGCTCCACGACGTACCTGTGTGGAGTAGCGCCCTC
GCCGAAATCTCGCGAATGCGATCTCGCACAAACTCGGCGCGTCTGGATAGCGGTCGCGCCGAGCGAATTATTCCCGGTTGTTGGAGTAGCGTATCTTCGA
AATACAGGCCCAAGTATTCGCAGGCTTCGGAGTTGGGGAGGTTCTTGTGTTGACGCTTGTTCCTTCTCGTAGGGCGTCGAGCCTTGGGCGTGCGGCGTTA
TCGGGCCGGCGTTTCCTGGGGCTTGTGTGGCGTTATCGGGCCTACACGGGGGGTCTTGTGCACGGCGGTTATCAGGCCAGTGCGGTCCTTCGCCTAGGCA
GCGCGTTATCGGGCGCCCACCTAAACGGTATACGTTTAACGTGCCTTTGTTCCAGCACGGGTCTGTGGGGGGTGAGCACCCGAATCAGCAAACGACGAGG
GGCCGCGATATCGAGGCGGCTCTACTTGCCTGCGCTTGGTGGTTCCCCTGGAACCTCGGAGAAGACGGGAGGTCTTTGTGGTTCAGAGAAATTTCGGGAC
TGAGTCCTTACCCTATCCTATGTCCTTGCTACTTGCTACTGGCTACTCTGTACTACTGCTTGCTAAGCCTACCGCTCTGGGCCTATCCCTACTTCTGTCG
TGCTTGCACTGCCGTCCTTCAACCTGGTTTGCGTGGCGCAATCAAGATCTTACCTCGGCGCGTTTTGGTCGGCGGGGGTTAGGGTCGGCGCGTTTTGGTC
GGCGCGTCTTGCTCGGCGGGGTTAGGGTCGGCGCGTTTTGCAGAACCGGGTGCACTGGTCGACCCGTCGGATGATTACGCGTCCCACTGGATTCTGGCAC
CGTGTCTCACGGCCCATCACCCACGCCGACTTTCCCGTCCAGCTCGGCCCTGCGTCGCGCCCATCAATCCGCGTCGCGTTCCATCAGCCGCGTCGAAGTC
CATCACTCGCGTCCCGGCGCCTTCTTCCTC