Description :
From Genome Similarity Track
Location :
Scaffold_1170:3144- 4182
Transcript NameFunction/comments
Physo_145413hypothetical protein

Sequence
1038 bases(100 bases per row)
CGGCCTTGTCAATGTCGTACTCCGGGCTGAGATCCGGCAATTCAGGGAGCAGGGCCAATTGGTCTCTCTGCTGTGCCATCAATTCACTTCCTTCATGAAT
GTACACTGCGGGTTCCAGGTCCAACTCCTCAGCGCTCACTCTCATGCAGCGAGCGTATTCGATCTTCAGCTGCCTGAGTGGAGTGCTGTCCATCGCGGGC
GTAGGCAAATCTACCTCGCATTCTTCCTCGACTTCACCTTCAGGTCCAGAGTCCGGAGCTAATTCCGGGCTGCTCGCCGAGTATTCCTCCAGGGTGTTGC
GTCCGGGATCAGGATCTTCATTCGACGCTTGATCGTCCGGCACGTCTGACTCCTCGCCCCGGGGTATCTCCTCAGCTTCTTCCTGAAACGTAACCTTTTT
CATTCCGGTTGAGGGCAAGCTCTCCGTCTCGTAACTACTCTGTCGTCTTTGTCGGACCGGGTCATCAACTTCGTTGGCCACGGATATGCGCGTTTTGGGA
CGGCGGGGGGCTGGGCGGCCCAAAAACGCTCCACCCGGCGCTCCTCTTCATCTCGAGCCCGACGTGAGGCTGTGCTCTCATAGATTAACCGTTCCCATTC
CTGATACCTGCGCACCCCAGGGCGCACGAAACACCCCCTACTCGGAAGTGTCCGTACTCCACAACCTGGGCGACCGGCGTACGGGTATCGATCCACAGAT
CGCGGTCCGAGATGTTAACCACGCGGATGGCCTTGACCCAGGATCTCGCTCCGTAAATTGCCTCCGTGACCCAGCGGTCTCCGCGTCCGACCCAAACCAC
ATCTCTTTGCGGGTTACTCCTGCCATAATGAACGCGCACAGTGGCGCTTCCCCCTGGCCGAAGGTATAAGTCATGAGGGGAAACAACCGGGATGTCCATA
CCGTGACTCTTCCGGATCGTGTCACCGTACATGAGAATCGCCTCTTCATCAGGAAGCATAATGAGTCCTTCCCGGATGCTGAGCCTAACTCCGGCACAGT
ACATGAAATCCATCCCGAGCAACACGGCCACGTCTTCT