Description :
From Genome Similarity Track
Location :
Scaffold_447:314254- 318185
Transcript NameFunction/comments
Aphin_H310_09190Hypothetical protein

Sequence
3931 bases(100 bases per row)
TGTTTAAAGAAATGGCATCCACCCAATGTACATTTGGGCCAAGTTTTCGTTGGACGTGGCTTCCGCGATGAGGCGGTCGACTTGTCCTTTCACGCTCAGC
GGCAACGTTTCGTGCTGCTGCTTCTTGCCGAGGTTCCACATGCCCCGCAGCCGTTCGTCGATCGTTTTGAGCATGATCTTGGCCTCGCTGTTAACTTGTT
CGTTGTTGGCAGCGATGGGCTTGAGCGCCGACGCCACGACCTGCTTGTTTTTGCTGCGACCCCACTCGACGAGCGGATCATGCACGAACGACTCGAGGAT
GCTGCGCAGAGTCTCACGATTGGCTCGCAGCAGCGTCAGCGTCACTTCGCACGTATGTCGATACACGCCCTCGACGCCGGTCAACCCAAACGCATCGATC
ATGTTGGGGGTGAGCCGGAACGGGACAATTTCCGGGCGCGCCAACTTCAAGCCCTTGTCAAAGAGGCAATCAAAGTCCACATGAACGCATTCGCCCGTCG
TGCAGTCGATCAGGATATTCTCCCCATGGCGATCTCCGAGCCCGACGATGTGGCCAACCATCGACCACACCGCCGCGGATCGGACGAATATATTTCTGCA
CAACGTCACTCGATCAGCTCGCAGTGTCGAGCAGGCCAAGCGCTTACCTGGCTTCATACCATGCCGTGGGGTCGCTAAAGTTGTTGAGGAACCACTGGTG
GAAGCGCGGCGTGAACGCGGGGTGCGTCAGGATTTTGGATTTGTAAAACACGGTCATCTTTGGCACGTCGTGCGCGTATTGTTTCTGCATGTTGAGAAAG
GTGTCCTTGAGCTCCGTCGTGAGGCGCACGGGCTGGAGGAACCCTTGTTCCGTTTTGTAGATTTGAGAAATCAAGTGCCGCATCGCGCGGGTATTGGGAA
CCCACTCCATGAGCCCGCTCTCTTCGTTCAAGCAAATGACAGCGTACGTGCGAAGGCGCAGCTTGCGCTTGCGGCCGTTTGTTTCGCGCTGGAGCAACTT
GTTCATGAGCGCGTTGAACTCCATCATCCGCGCGTCCTTGCGCAGGTCGCCGTGTTTTTCCCGCTTGCACAAAAACGAGTACGTCTTGCCATCCGTGCCT
TGGATCTGGATGCGTTTCGGCTTTTCTTTCGTCAGCATCACGTCGGCCTTGTCGCCAAACGACTTGATGTACACGTCACTCTCGGGGAGGTCTCGACGAT
GGATGATGTTCTGAATCGGTAGCAGCACCTTGGCACGTACCCGCGTGAGTCGAATCGGCATCTTCTTTTGGTTGCCAGGGTCGAACTCGGCGAGTTTGAT
CAGTTCTTCCACGAGGCGCATGCCTTCGCTGAGCGCGTTGGCCATGCCGACTTGGTTGGAATTGGTCAGTTGCTTCTGCGCGACTTTGAGGATCTCAATC
GCCCGCGTCTTGCGCTGCGTGTTGAGCGACTGCGCCAGCCCTAGGACGTACCACATCGCACGCTGTGGAAACGTCATCAAGACCTTGACCATGATTGCTT
TGACGCCGTCGACAACCGCCACGTTGGGGTGGCAGATTCGAGACGTAACTTGGGGAAAGCACACGAGCCACATGCTTTCGGGCAAACTGTGGAGCGCATC
CAAGATAATCTTTGAAATGTCCTGCATCAAGCGATCCCCGTCGTTGTCTTGAATGTCGAGGCGGTAGCTGCGTTTCGAGCTGGCTTGCAAAATCTCGCCA
AACTCGTACCAAAGGGTGAGCAGCCGCGGAAGGGACTGGAATAAATATTTGTCCGTCCCTTTCAAACTCAGCACATAGTTGTGCAGGACGTGCGGCAAGT
AAGCATAAGGGTCCGTGCTGTCTTGGATTTCCCGTCGATCGCTCTCGAGGAGGACTTCGTAGTACTTGGCAAGGCAAAAGTACCCCTTGGCGTAGTCTTT
GTCGAACGCAATCACGGCTTTGTACCGGTCAATGACGTGCTGGCCTTGCTTTTGGCTAGACTGTTGCATGTAGTTCGTGGCCAGAAGCAACGTCTTGGCG
TGAAAGTGGTTGTCCGCCGTCCGATGCTCCAATGTCGACACGTCAATCGGAATCGGTTCCAACACGTGCAGCGCTTCGTACATTTTGCCTCGTTCGACCA
GTAGCTTGGCTTGTTCGATGATGGCGGTACGACTTCCCAGCGCCTGGGCGTGCATCATGGCGCTTTCCGCGGTCCGGACGAGACCTTCTTTTCGCGCCAT
TTTCGCATACCGCAGCCAGTTGGCCGACACAAGGTCTCCATCGAGCTGCAGATCGTGCATCATGACTCGTCGCAGGGCCAGAATTGGCTCCTGGAACTTG
AGCGCGGGCGCCATCATAGCATCTCGCCGGGTCCACGGACACTGAGCATTCCATGCGTCGGTTCTCTTGGACGACGTGGAATTGGAGGAAGTGGTGGCGA
CAACGAATCCTTGCTCCAACTCGTGCAAGAAATGCAGCTGGTTCAGAAGAGGGTACACGCGTTGATATGACTCTTGCGAAGCGGCCGCCAACGGTCCCAT
GATCGCTGCCCGCGCTTCGCGCACTTGCACGTGCATGTTGTTCTTGTCTTGGTGAAAACACAGAATCGCCTTGGCAAACTTCATTCCCATCATGTCTTCG
TTGTCGAGCTTGACTTTCATCGCGTCCGTCGTGAGTTCGGCGAGGAGATCCCACCGCGAGAGGCGCCACGCGCACTCGAGCGCGCAGGGGTACACCGCCG
GGATCACTTCTGGGTACTGGTTCACAATGCCGCGAACGTGTTGCAGCGCCCCTTCCAACCGCCCGAGTTGAATCATACACTGGATCACCCCCGAGTACAA
CTCGCTGCGGATATCGACTTCGACGTCCGATCCGTGCATGTGGTGTATTGCTTGCTCGTAGCACGCCAGGGCGTCTTCCCATCGCGCCAAGTGTTTGTGT
TCTGCAATCAAGTGCTGAAGCTCCTGGAATGACCCGGTCGGTTGTGGGTGCAGCCATCGCCGTTGAATGGCGAGCCCGAGGAGGGCGTCGGGTTCGTCGA
GACTACCATACATCTTCTGCATCTTGGTGATATCGGACGACGTCATGTGGACACCGGCGGCGCCGCCTTGTTGGCGCAAGTGGCTTTCAAAATACTGGAT
CGCGCGGGCATACGCTTTGATCTTGAACGCGGCGGACGACAGCAGAAGCAGTGGAATGTCTTTCAGAAACTCCTCCACAACTTCCTTCTCTTGGTCAAAC
ATTTCGTCAATGTGCTTGGCCATGTGTGGCTGCTGGCTCATCGCGATTTTCTTGCGCTGGCTCGCCCACACCCAGTCGTTCAGTTCGTCCAGCATCGAAA
ACACCGTTTGCGCGCACTGGTGGTGGTGGCTCGACACCGCGTCGCTCATCATGTCCAAGCTGTCTTCTTGCAGCACGCTGAGAATCTCCTGTTTTACCAT
GTTGTACGACGACGTTTGCTTCAGGACGTTTTGGACCAAGTACGGCAGGAGGAACCGTGCCATTTCGAGCGATATTGTCAACGCTCGACGGCATGCGAGG
AAAATGTGGCGCTCGGGAAAGGTCGAGTGGTCGATCAAGTACTTGCACCACGACACGAGCCACTGGTCAAATGCCACCGACCCGAGCGCTTCGTAGAACG
TCGACGACGCCGGCATCGTCGTCGGTTTGAAGTTTGGCGCTTGGTATTTGGTGGACCAGTACGGGGCAATGATCTTGTCGACTCCTTTGCTTTGAAACTG
GCGCTGCATCCATTCCGGCATGGTCGATGTCGATTGCACAAACCCCGCCGAACTAGACGGGGCGGACGGCGCTGTGCTGTTGGAGTCTGGCGCGTTCAAT
TGTGCGAGAAACTGAAGCAGCTGCTGGATCGACAACGCGATCACGTCGGTGTTATGGGGTGCCGCGCGCAGTTCTTTGACCAGGAGGGTTTGGATCAAGT
GGCATGCCAAGTTCTTCGTGCTCAGTTCGTT