Description :
From Genome Similarity Track
Location :
Scaffold_134:31415- 33637
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_134-fgenesh-gene-0.9Protein SMG9

Sequence
2222 bases(100 bases per row)
TCAGTAGAACTCCCGACCCGTGTATTCCTCCGATAGAGCACTCGATCTCTTAATGCTCTCCCACACTCGCGCTGTGTTACTTAGCCATTCGCGCAGTGTG
AGCGCATGACTTGATATTTTCTCTGTAGCCGACGTGAACGAGTGCGATACTGGCAAGGCTTTCACCATTCGAGTCCACTGGTTTGTACGCGTATCAGAGC
CTGAGCTATTTCCAAGAGAAGCAACAGACCACAACGCCACTTCCCCTCCCTCACGGTGCAGCCAATCGGATGGAAGGAGACGCGAAAGCCCGGTACTGAG
GTGACGGTCGCCCATGGGCTGCGTGGCGGAGCCTTCATTGGCCACGAAAAGCAGCTGCGCGTGGTGCTTCTCGCCGTTTGCTTGACCAGACACACTGGGG
AGGCGGCACTGCTGCATTTTGTCATAGGCTTTGCGCAATATTTCGATCAACTCGACGTCGACGCCACTTGGCGACGGGATAATCACGTAGTGGCACACGG
AGAGGAGCAGAATCACAAGTTGAAGAGAGGCCAGTTCGACTTGATGCTCGGGAGACGGCGCACTGAAGCGCGAGGAGGACAACGCCATGGATGAGGATGA
AGACGACGACGGGTCGAAACGACTCAGCACCTCAGCCAGATTGGTGCCGCTCAGCAGCGGCTGCGTGTCCAGCAGCACGAATCCACCCATATTGGCTCGC
TGCTTAGGCTCTTCACAAACCACCGCCAAGTCGACACCTTGGGTCTCCTGATGAGGcACAAGCTGCGTCTCGACTCGTTGCGCTCGAAACACGGGGgTAT
CCGACGTGTTCGTTtCGCCACAGAtGCTTTGCGCCAGCAGCGACAGCAGTGTCGACTTGCCGGACCCTTCAAACCCGAGGGTGCCGATGACTGTGAAGTG
AGAGAGCTCGAGACAAGACGCGAGGCGCGAGGGGATGTCACTAGCGAACTGGAAGTTGGGGCCGATGAGCTTCGTGGCGGACGAGGGAGGACATACGAcG
GGAGGGACGCTCGCACTTGCTGATCTGGTGGAAGGAGGTACGGGATTCCCAcTCGAGGCACTTGGAGTGGGTGGCTGTGAGGAGCGACGCAGCCCATGAG
GTGTCGTAGGAGCAGCAGACGGAGACGGCGACGGAGATGAaGCaTAAGACGTGCTGACACGGAGTGAACCTCCACGCTGCTGCTGCTGGGATtGACGTGA
TTCCGGGATGAACAAGTTCCCcGTCCGGATGGGAGCTGCTACTGGAGGAGGCGACGcaGGCGTCGATGGGCcGGgTGGAACGGGaCCAGACGAGCGCAGG
ATCGTAAGAGGAGGTTTGaTAGGCCCAGCAGCTGCTGATGGCGACGTTGACGCTGCTTGCTTGGTGCGGCCCTGTGGAGGGATGaGAGTGATGGCGAGAG
TGACAGCAGTGGAGAGAGGCGACTCACCCTCGAGGCGGCGCTGCGGAAGGCGCGAGTGGGCGCGTCACTCGGGCGTGGCCCTCGCCCACCGGACGTCCTC
TACGCAGCACATGCACCCGTCaGTCTCCGCCAGGCGGCGCCATGACGCAGCCACAGACCTTCTGCCGCTGCTTCAGCGGCGTTTGCTCGCGATCCATCTC
TCGGAACTGGCGTAACCGAGGTTACACCATGAGTTGGCTCTCGACTCACCTCCTTtGGTACTGGACAGTGAGGAGACGCATGTgaTGCTGGATGGCGATG
GATGCAATtGCGATGGACTCTATTGATTTACATGCATGCGGCGACCTGCTTAGTACACGTGCCGATACTTCTCTCGTCGcTGGTGGcGCTTAATGTCGCG
CACACTCTGACCGTTACGCTTGCTCTCGCCCGCGCGCTCCGTTGCCTTCGACTGCTTTTGCCTCGCTCGGCGCGCCATTGTGGACGAGCCCTTGCGATTC
AGCGTGGACGAGAACGCATCCGACTGGGACACCTCACCAGCAAAAGCATCAATCGCCTGCATAAGCGCAGTAGCGGGTGCATTCTGCTGAGCcTTCTGTT
GTCGGCTTAGCCGCTCCTGTCGCCGTGCTCGGAGGTCTGCATCGACCTGAGCCTCGTGCTGTCTGTCCATCTCCTTCTTTGCGAGCAATGCCTTGGATGA
CGAAGCCACAGCGGCActGGCCGCGTCCAACTCGAGCCCGAGGTCTGAGAACGCGGCCATCATGCTGTTCTTGTCTTCCTTtGACCCGATTTTACtCGCT
CCGACAGGCGCGACTGCCgCAG