Description :
From Genome Similarity Track
Location :
contig_4:314044- 315357
Sequence
1313 bases(100 bases per row)
TTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCGCATGCTTGAGGCCCAAGAGCAAGACGTTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCG
CATGCTTGAAGGCCAGCAGCAAGACGTTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCGCATGCTTGAGGGAGACGTTCCTCCTCGCAAACGTGTA
GCAGACGTTCCTCCTCGCATGCTTGAGGCCCAAGAGCAAGACGTTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCGCATGCTTGAAGGCCAGCAGC
AAGACGTTCCTCCTCGTATGCTTGAGGGAGACGTTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCGCATGCTTTCGGGCCAAGACGTGCAGCAGCA
AGCAACCCACCAGAGCATCATCGCGGAGGACGGTCTTGAAGAGACAGACAGCGACAACTGGGATGTGCTGCTCGGGGCGGGGAAGAACCTCAGAAGAAAA
ACTCTTGCTCAGCAAGCTGATGGACTCTAAGGAGCGGAGAAAGCTACTTGTGTCGGGTAGACACCCACCCAACCGCTACCAACCCACTTGCACAAAGTGG
CGTTTGAGCCCTCAACAGCTGATTGTCTTGCTGCAGGACTCGACCGCAAGCCTTGTATGGCAGCTCGATGGAAAATAACAGTAGTATAAGACTTGCTTCA
CCTTGAACATATACATCACTGGAGAATCCACACCACGGATATGCGCCGGCCCGCCATAAATTGCACAGATCCGTCAACTTCGCTTGATCCATGTGCGGCC
CAAGTAAAGCGCAGTCGGCAGTGCCTTTTTAGTCTACTGCAGTGTCAAACCAGCACGACCTGGGCATCCACAGACAACGGCTTTGCCTTCCTTGCCCACC
AACGTACATCTCAACACAGCATGCGGCTATCCATGCCATCGCTTAAAGCAAGTGAACCCATTCCCAGCTTCAACGAGGGTGAAGCCATTTGAAGCCGGTA
GGTTCCGCTTCATTTCGAAAACAGCACAGTCCTCAACTACACGGACAGCAAAACCCGACGAGCATCATGCGCACGAGCTTCTTGTTGACACTGGTGACGA
TCGTTGGCGTGCTGCTGGCTACACCGGTCGTGCACGCCGAGGAGGGGAGGATCGAGGTCGGTCAGCTCAAGCGAAGCCCCGCGCGCCGTGCCGAGGAGAC
CAAGGATAAGGTCGTGACCGCCAGTCTACCCAAGATTGCTCACTAAGGTGGCGGCGACAGTTGGCAGAAGCACTTGGTCGTAACGTAGGCAGTCAATGAA
AACCCCTTTACCA