Description :
From Genome Similarity Track
Location :
contig_4:314030- 315343
Transcript NameFunction/comments
g1362.t1hypothetical protein

Sequence
1313 bases(100 bases per row)
AAGAGCAAGACGTTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCGCATGCTTGAGGCGCAAGAGCAAGACGTTCCTCCTCGCCGACTTGAGGGAGA
CGTTCCTCCTCGCATGCTTGAAGGTCAGCAGCAAGACGTTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCGTATGCTTGAGGGAGACGTTCCTCCT
CGCAAACGTGTAGCAGACGTTCCTCCTCGCATGCTTGAGGCCCAAGAGCAAGACGTTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCGCATGCTTG
AAGGCCAGCAGCAAGACGTTCCTCCTCGTATGCTTGAGGGAGACGTTCCTCCTCGCAAACGTGTAGCAGACGTTCCTCCTCGCATGCTTTCGGGCCAAGA
CGTGCAGCAGCAAGCAACCCACCAGAGCATCATCGCGGAGGACGGTCTTGAAGAGACAGACAGCGACAACTGGGATGTGCTGCTCGGGGCGGGGAAGAAC
CTCAGAAGAAAAACTCTTGCTCAGCAAGCTGATGGACTCTAAGGAGCGGAGAAAGCTACTTGTGTCGGGTAGACACCCACCCAACCGCTACCAACCCACT
TGCACAAAGTGGCGTTTGAGCCCTCAACAGCTGATTGTCTTGCTGCAGGACTCGACCGCAAGCCTTGTATGGCAGCTCGATGGAAAATAACAGTAGTATA
AGACTTGCTTCACCTTGAACATATACATCACTGGAGAATCCACACCACGGATATGCGCCACCCCGCCATAAATTGCACAGATCCGTCAACTTCGCTTGAT
CCATGTGCGGCCCAAGTAAAGCGCAGTCGGCAGTGCCTTTTTAGTCTACTGCAGTGTCAAACCAGCACGACCTGGGCATCCACAGACAACGGCTTTGCCT
TCCTTGCCCACCAACGTACATCTCAACACAGCATGCGGCTATCCATGCCATCGCTTAAAGCAAGTGAACCCATTCCCAGCTTCAACGAGGGTGAAGCCAT
TTGAAGCCGGTAGGTTCCGCTTCATTTCGAAAACAGCACAGCCCCCAACTACACGGACAGTAAAACCCGACGAGCATCATGCGCACGAGCTTCTTGTTGA
CACTGGCAACGATCGTTGGCGTGCTGCTGGCTACACCGGTCGTGCACGCCGAGGAGGGGAGGATCGAGGTCGGTCAGCTCAAGCGAAGCCCCGCGCGCCG
TGCCGAGGAGACCAAGGATAAGGTCGTGACCGCCAGTCTACCCAAGATCGCTCACTAAGGCGGCGGCGACAGTTGGCAGAAGCACTTGGTCGTAACGTAG
GCAGTCAATGAAA