Description :
From Genome Similarity Track
Location :
Scaffold_77:31402- 34277
Transcript NameFunction/comments
Phyke_g3244hypothetical protein PHYSODRAFT_558912

Sequence
2875 bases(100 bases per row)
GATCATgtgctggtgtggctgccaGCAAACAATTTGAGCCGCTGCAGTCCAGCCATGATGTCAGCGAAGCTTGGGCTGGGACTGGGACTgcggagcagga
ggaggctgcacaGCCCTCGGTCTGGTCGGGATTCTACAACAAGACGCTGCGTGAGAGGATTGATGTGCTAGCATTGATGTATCCGAGATTGCAGCGTCTC
AAACAGGCGCAGACGACAGCTGCGGAGGTGACAGCAGACCTTTTGCCCCCGTCGGACCCAGCCGCTAGGCTCGGTGAGCTGCCGTTGCGAACTGCCAATC
TCATGATTGAGAACTGCATCGGCGTGCTCGGTATCCCACTTGGGTAAGTAACTATGTGATTGAATTACTCATTATTTGGCTAGTCGTGGTATAGGCCGAC
GATGCCATTCGATTGACGTCCCTGATGTGCTGCATATCTGGTTATTGTAGCCTCGGTTTGAACTTTGTTATTGATGGCAAGAGTTTGTCGGTCCCGATGG
CAGTGGAAGAGCCCTcagtggtggcggcggcgtcCAGTGCAGCGAAGCTCGTGGCTGCTGCGGGCGGAGGTTTCCACACAGCGACGTCCGGCAACATCAT
GACGTCGCAGATTCAGTTGGTGGGGACGGAGGACATTCCAGCGGCAATTGCAGCCATTAAGGATAATCGTGAGCGCCTGTTGGCGATTGCTAATAAGACG
CTATGCCCAAACATGAAGAAGCGTGGCGGAGGTGCCATTGATATTTACTGCCGCGTGGTTAGCCAGGCCGCTCGgacagcagccactgcaaccGCTGGGA
GTGCTTGGTACACTCCTTGcgacgacgaactggtgGTAAATGCTTCCGAGTCGCAGACGCATTTCTTGGTTGTGCATATCGACGTAGATGTGTGTGAAGC
CATGGGCGccaacatcgtcaacacGGTTGCTGAAGGGCTCTCGGAAGAAGTCTCCAAGCTCACACGAAGCCGCGCGGGTCTGCGTATTCTCACAAACCTC
TGTATGCAGCGTCGCGCGCGTTCTGTGTTTGAAATTCCGCTCCAAAAACTTGGTTGGAAAGGAGTGGATGGTGAGGACGTCGCGAGCCGCGTCATCGAGG
CGTACAACTTTGCTGCTATTGACCCGTATCGCGCGGTGACCAACAACAAGGGCATTATGAACGGTGTGGACGCGGTGGCTGTGGCCACAGGGCAGGACTG
GCGTGCCATCGAGTCTGCTGCGCATTGCTATGCTAGTCGTTCAGGGCAGTACACGTCGCTCTCTCGTTACGAGATTGGCCTCGCCCGCGATGGATCAGGC
ACGCGTGTGTTGCGCGGCAGCCTGGAGATGCCCATCGCAGTCGGATCTAAAGGCGGTGCGTTAATGACACATCCGGGTTATACGGCCACGCACGCAATTT
TGCAGCAACCGACGGCCCGTATATTGAGTGGCATCATCGTGAGTGTTGGGTTGGCGCAGAACTTTGCGGCTGTTCGTGCTATCGCAGTGACGGGCATCCA
AAAGGGCCACATGGCACTCCACGCACGCAACAttgcagtagctgctggtgcccCAAGCGAGCTGGTGGCAGAAGTGTGCAGCTACATGTTATTGCGGAAG
GCGATCAACGTGGAGGCGGCGAAGGAATATCTCCACGCCCACGCCGTCTTCTCTGAAATTCAGAGCAACTCACCACCGTTATCTCCAGTATCAGTGACGC
TGCCGTCTATGTTCTTTGTGGAGATCCCCATTCCAGAACTAGAAAGCACGATCAGCCTCAACATTGCATTCGAAGCCATTAACAAGCGCCCGCAGTACAT
CGCGATCATGGCACCAGATGGACGCAACAAGGTGCAAACGACACTGCAACGGCAACTGCTGGGCGACAAAGGCTACAACCAGCTCGAAAAGATGTTCATG
TTCTTGGCGTCTATGCGCTCAATCGTCATCTCCAACTCGAACGAGAAGGGCGGACTGCCTGTTTCGCGCTCGAACATTGGGCTACAGAACAAGCTCCAAC
TACTATCCATTctcatcaacatcatcgcgTACCGCCTCATGGAGGTGCGTCCCCCAAAAGTACGCACGTTTTTGCGGAAACTTCTGGAGGTGAGCGGCGG
GTCTGCAAACGGAGCCCACGATGGTGAGTTGCATGAGCTGGACACAAAGTGTTTTCACGACCTGATGGTAGAATGCGTGGAGCCTGCGGATGAAATCCTG
TCCACAGGACTGCCACTGTTCCTCGCACTGTGGCAGGTGCTTCACTACCACCTCGAGCAGGAAGTTCCGCATAAGCTGCTTCGAACCCGATTGATGAAAG
AGCAGTGGGGGCTCGTGAACGATATCGTGAGGAGTTATGAGCTGGGCACGCTCTCCACCGATACCGCTGGCGCATTGTCTGAAAACATAAGAGCACCCGA
CAAATTGCTGGAAGAACGGTTCTTGGAATATGTTGCAGTGCAGGCCACCCGCTGGCAGGCGACATTGCTGTTGCTTATCGACTCGCTGGCATTGGCACCA
GAGCTGATAACAACCGAGCGGTTAGATTTCCTTACGCGCATCGGCGAGTACATGGAGTGGGAAGGCTCCATCGCGCACGACCTGGCGCGCTACCAGCGCG
ATGCCACTGAGCGCGTGCCCAACGCGTATCTCTTTTGGCTTTTCCAGCGCGGTATCCCTCATTCAGAAGGCAAGGCGTACGAGAGGGAATTCCGTGGCGT
GGCTGACACGTTGGCTGAACAGAAATGggagcagcttctcctggagGCGCGCCGTGACTCGTGGGCCGCTGCCACTTTctcacttccagcagtggAGAGA
GTGATCGGTCTTATTCGCGAAATCTATGGCGACCGCAGCGGCAGTCACAGCACGCGAAAAGAGTCCTTTTAAGAG