Description :
From Genome Similarity Track
Location :
Scaffold_187:314- 3681
Transcript NameFunction/comments
g9566.t1POM60411.1 LOW QUALITY PROTEIN: Pol protein [Phytophthora palmivora var. palmivora
g9567.t1hypothetical protein

Sequence
3367 bases(100 bases per row)
GCCATCGGGTGTGCACTGCTGCAAGCAGACATCGAAGGGCGTGAACGCGTAATTGCGTTTGAGTCTCGCCAGCTTAAAGCTGCAGAGAAGAACTATCCAG
TTCATGACAAGGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTTCACCTGCTAGGCTCTAAGCCATTTGTCATCTTTACTGATCATGCGTC
ACTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAGAGGATGGCCCGCTGGCTCTCCTTCTTTGCGGAGTACAACGTCGAGGTGAAGTACAAGCCTGGC
AGGCAGAACGGGTTAGCGGACGCGCTGTCCCGCAGACCCGACTATGAGTTATCTCATGTCACGACTGTGACGTCGTCCGTGACGGACTTGATCCGCGCTG
CGTATGCGCGTGACGACATGTGTGTCGCTCTGCTACGTGCTCTTGGGAGCAAGGAGTTTGGAGACTCGGACTGTAAGCTGTCGGCGCGCTTACGCGCGAG
GCTGCATCGATATTCGCTCGATGATGGCCTGCTGTATTACAGCACCGATCCGGAGGATACTCCACGTATTGTGGTCCCTCACGATGAGGATCTGAAATAT
CGTATCCTCTATGAGGCACACGATACTGCGCTTAGTGGCCACTTTGGTCGTGAAAAGACCTATGGCTCTGTGAGCCTCTCCTATTGGTGGCCCAAGCTTG
ACAAGTGGACGAGCACGTATGTGCGCACGTGTGAGACGTGTCAGCGGGTGAAGCCCTCACCGCATGCGGCCGCGCCGCTGGCAAGCTTGCCTGTACCCTC
TGGGTGTTGGGAGTCCATGAGTATGGACTTTGGGTTCGGCCTTCCGAAGGACTCGGATGGCAACACGGGCATCGTGGTCTTTGTCGACCGTTTGAGCAAG
ATGGCTCATCTAGCGGCGGTGCTGGACACCATTGATGGTAAAGGTACAGCCAAGCTGTTTATCGACCGGGTTTTCCGCCAGCACGGGCTGCCCGATCGGA
TAGAGACCCCCGTTTCACGGGTAAGTTCTGGTCGTCCTTCTTCAAGGTGCTGGGCACCCGATTGGACATGTCCACAACGGATCATCCACAGACCGATGGT
CAGACCGAGGGCGTTAATCGCGTCGTGGAGGACGTCCTCCGCAGCGTTTGCGCCGAAACGCCCAAGCGTTGGAGCACCATGCTTCCACTCGTGGAGTTCG
CATTGAATAATGCTGTTCATGCCTCCACAGGCTTTACCCCATTCTACGTGAATGGCCTCACCCACCCTCGCGTCCCGTTGACGCTACCACTCCGTGGTTC
CGGGCTTGGTGGGGGAGAGATAGTCGGTCGGCTTGCTGATGTCAGCCCTCTCACTGTTCGTAAACAGGTTGACGAGTTTCTGTCAACGCGTCTGAGTGTC
CTTCGACACGTACGTGACGCTATGGCTGAGAGCCAAAACCAACAAAAGGAAAACGCAGATGCCAGGGGCAGAGGTAACATTGAAAGTTACGCAGTCGGAG
ACTTGGTTTTAGACTTGGTTTTATTAAACGCAAAAAACCTACCTACACATGCAGTTTCTGCGGTCTTCAAGACGAAGCTGCGCCCACGCTTCATCGGACC
TTTCAAAGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACCCATCCGGTGTTTTATGTGGGCTTGCTCAAGCCGTAC
CGGGACCCGGCGCGGGTGAGCGCGGAGGCGCTGGCACCGGGACGTGCACAGGTGGCACAGCCACAGAACCCTGCTGAAGTCGCAGCAGAAGGTCGACTTG
ACCCTCCAGCCTCGCCAGACCTCGCTCAAGGTCGGAGACCCGGTTCGCCAGCGCAGCTGGGGCCTCGAACCAGTCGACGCGCTCCCGGAGCTGATCAATC
TCATGCCATGAGCGATCATAGGCGTTCTCGGCCTGATGGAGAGTCTCACGGAGACGTACGACCTCCCGGCGCAGCGATCCCATCGCGTTCCAAGCGTCCT
CAAGCTCCGAACGATGCACCCAGTGCATCTCAGCGTCCGCCACCGGCGTTGCTCGATGAGCAGGGCAATCGCCACTTCCATGTGGAACGGATTGTGGCTC
GGCGTCGCCGCCAAAATCAATACCAGTATCTGGTGAAGTGGCGAGGGTACCCCCACTCGCAGAACTCATGGGAGTTTGAGGTACCCCTCCGGCAAGACTG
CCCTGACGTCGTGGACGCTTTTGATCGAAACGATCGACGGCGCCCTGGGGGCTCGCGACCGGCGCGTCGGTCGCCACCCGCTTCCCGGCAGTAGGTCGGG
GAGCGAGGGGGTCAACAGCTGAGCTCAAGCTTTGACCCTGGGCTGCTGCAGCCGACGATCCACCTTGTGGAAGGTCTGCAGAGCTCGGAGGAGCATGTTG
AGGAGCCCGCGCAGGGCGGGGCTGGAAGCCCGAAGGAAGTTGGCGTTTCGCCTTTAACTTCGCGAACGCGAACCGGAGCCGACGCTCTAACAGGACGTCG
TCCTTCTTGAAGCTAGCTTGCAGGGCGACAATGGAAGAGAGCTTACGAGCCCCTTCCACCCAGAGCTCGAATTGAGCGACATCCTGCTCCTGGCGTTCGC
CAGCCAGTAGGACCACTGGATACGTCCGCATTTGCGGCACGGACGCCCCCCGGGCTTGGAGCTGCAGGCGCTCACGGTACTCGCGTTGAGTGGTAAGCTG
AGGCGTCAGCAACCTCTGGCGGAGGTCTTCTCGTTGAGCGACCTCTTCGTTGGAATGGGCCGCGGGTCCGATGACATAGTCATTCAACAGTTGCGACGCC
GCTAGGCGAGCCACTTCGTTGGGGTCGCGTGGCTCAAAGCCGTAGTCACGGCGGCTCGGGTGGAGCAGAGGCCGTGCTATCGGACGCTGGGCGCGGGGCG
CCTCTTCCATCGCGGCCAGTTGCTGGCTTTGGACCTCGTCGAGGTTGTTGGAGACAACGTTGGCCTCCATAGGCTCGTCCTCGTCTCGCGACGGGAGTGA
CGACGTTGTCCGCAACGCGGTCAGAGCTGACACAGCGTCGCTACGTTCTACGAACGGATTGGGCGTGCGTAGGTCACGCTTATCGGTCGTGCGACCCCGT
GGAGGATCCTCCTCCTCTTCCCGGAGGCAGGTATCACTGCCGTAGTCGACCTCCTCTCCCTCTTCGAGGCCTTCAAAGAGGGTTTCATTCGCGCGGCGAA
TACGCGGCTTCGGCGCGTCTGCCGAGCTTTTCGGGGCCGACATAGCGACGCGAGCTTGTTTAAGCTGCTGCTTGGAGTAATACTCCGCCACAGAGAGCGT
GGTTCTCGCCACAGGCGCCGATGCGTTGTGGCCAGCGGCCGAGGAAGCACTACGTGCGGACGTGTTA