Description :
From Genome Similarity Track
Location :
Scaffold_1526:314- 2847
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1526-fgenesh-gene-0.0Protein kinase
Pytiw_DAOMBR242034maker-piw_contig_1526-fgenesh-gene-0.2Ubiquitin carboxyl-terminal hydrolase and/or F-box protein

Sequence
2533 bases(100 bases per row)
TGAGAACTACCTCAACGCCGTGCTGTCGCTGCGTCCGCGGCCCGTCGAGCTCGCACAGTTCCTCTCGGGCGGCCAGGGACAGGGCGACGAGGACCTCGAG
GCAGACCTGTTCACGGACATTTCGCACCTGCTCGGCAGCAACTCCATGGCCGCAACGCCAGGGAGTGGGCCAATCGCGACTCCCTCACCTGTTGCGTCAG
CGAACAGCCAGCTGGTGACGATGACGGACTTTGAAATCCTTAAGATGCTCGGCAAGGGCTCGTTCGGCAAGGTATACATGGTGAAGCGCAAGGCGAGCGG
CGAGATCCTCGCGATGAAAGTGCTGCGCAAGGCCGAGCTCGTGAAGCGCAGCCAGGTGAACCACACGATGACCGAGCGGCGCATCATGAGCTCGGTGGAC
CACCCGTTCATCGTGCCGCTGCGGTTCGCGTTCCAGACGCAGACCAAGCTCGTGATGATTTCGGACTACATGTGCGGTGGCGAGATCTTCTTCCACCTCA
AGAAGTTCCGGTCCTTCTCGGAGGCCATGGTGCGCTTCTATGCCGCCGAGCTCGTCTCGGCACTCGGCCACCTGCACTCTAAGGACGTGATCTACCGCGA
TCTCAAGCCCGAGAACATCCTGTTGGACGAGTTTGGCCACATCCGACTCACGGACTTTGGCCTGTCGAAGACCGGCTGCAGCGACTTTTCCGGGGCCAAG
ACTTTCTGCGGCACGCCCGAGTACCTCGCGCCAGAGATGCTCATCAGCCGCAAGAAGAAGACCGAGTACGGCAAGGCGGTCGACTGGTGGAGTCTCGGCA
CTCTCATGTACGAGATGCTCACGGGCTGGCCGCCCTTCTTTGATCGCAACATTGAGCAGATGTGCACCAAGATCATGAAGTCTCCGCTCAAGTTCCCGTC
GCACTTTGGCCTGAGCGCCGAGGTCAAGAGCATCATTTCTGGGCTGCTGGAGCGCGACCCGACATACCGACTCGGGTGCCGCCCTGGCGCGGGCGTCGAG
GATATCAAGAAGCACCCGTTCTTTGCCGAGATCAACTGGGAGCTGCTGGAGAACCGTGGCGTCAAACCACCGTTCAAGCCGCGCGTGCGCAGCACGACGG
ACATCCAGAATTTCGACCGCGAGTTCACGAAGGAGGCCCCCGACCACCAATTTCTCCAGGTACGACAATTTCGAGATTTGTTGTTACACTTGCTGTGGAA
AAATTGGACAGCTGACTGATGTTTTGTATCTGTGGATTCTAATTTGACTCTATAGCAAGACAAGCGGCTGATCGTGTCGCCGAAGAACGAGTTCAACGGC
TTCTCGTACACGCCGCGCACGGCGACTTCGAAGGGAAGGTCGTCGTCCGCGGCCATGGACCGCCACTCGCGTCTGAGCGGCGAGGGCTACGACAACAACA
ACGCGCTGCGGAATTTCTCCATCTCCTGAGTGGGCGACTTGCAGAAATAACTGAAGCTACGACAAAAATGACTGGACAGCGTGCGTCGGGAGCGAAGAGC
TACGAGTGCAGAAATCTACAACTGAATTATAACTATGTGAACAAGAAGAAGACCCGAAACGCGAGAAGAGTGTACAATTGGAGAGGCGCAACGAGAATAA
AGAGAGCGAGGACGAGACTGTTGACGCCGTGATCGAGAGTGGCGACGAGCGTGTGGATAATTCATTGTAAGCCTGGCCGCAGTGCGAGACAAGAATGGTG
CTGCTGTGCGTGTAAAAAGAGAGAGAAATTGTGATTTGATTGATTTTTTTGGTGCTGTTTTAGAATACAAAGAGATTGTTTTACTTGATGATACTGTTGC
TTGTTGTTGTTGTGTGATAATGCTTAAGACGACGTCGAATGGAGGCTGGTGACTGCTACGCGACGACTGGTGTTCCCTTGTTTGCGTGTGTTTCTTCTCC
TCTTGCTTGTATCGGATATCTAGTGCGGGGCTTGGACTCTCTCGCTTGGTGGAAGATCTAATTTACTGCCCATGCGTGACGTTGTTGTTGTGGCGAGTGG
TCTTGTTCTTTCGCTTGTTGTTGTTGTACTGGTAGAACACGGGCATCATCTCGCGCATCGGGTGCGCGACGCTGTGGTCCTTGAAGTTGTAGATGCGCTG
CCACTTGCCGTCCACGTTCGCGTACCGGTGGTTCACCTCGTGGCATTGTGCTGTTGTCGAAACAAATATCAAACAAGCGCAACAATTTTCATCAGCACGC
CAGCAAACGAACAAACAAGACGTGCACACATACACAACACTCACCATTGCATGCGCGGCACAGGTCGTAGTCCGTGCACATGGAGCAGTTGAAGCGCGGG
CCCTTGAAGTCCGTCTCGCCGCACGAGTCGCAGATGAAACCCAAGTGCCGGCCCTCCATGATGTACTTGAGCGTGCGCTTGCCGTCCTCCTTGCACTTGC
GGAACGCGCTGCGCACGCGGAACTTTGGAATGTCGAGCTTCTCGGCCAGATTCTCAATGGCTTCGAGCGTCGGCACGACTGCAAACGGCCGCTCGGCAAG
AAGCTCCTCGGCGTGCAAATACTGGGAGAGCAA