Description :
From Genome Similarity Track
Location :
Scaffold_932:314- 2647
Transcript NameFunction/comments
Phyta_totarag11413PREDICTED: copia proteinlike putative

Sequence
2333 bases(100 bases per row)
CCGATGGAGAGAGGTTGCGTGATAGCGTTGGGATGTGCCTCACGTTCGTAAGCACACTCTTCTTCATACCGTGAGGcgccttcatcatcatcacaATATC
GCCGCTACCGATAGCCTGGACTATTCCGTCGTCTGCGAGACACACGTCCACAGGCGTGTAGGCCTTGTAGTTCTTCATAAATTTCGTGGATTGCGCTAtg
tgctgcgtcgctggcagcaccgccatcgcCGTCAACGAAGAACAGGTAGGCGCCAGaatcttcttcacctgcGCGACATTCGCACGCTGCGATCGCTGAC
GGTCGTTGTTGTCTTGGATCTGCGACGAACACTCTGCGATCCAGTGTCCTTGTTTTCCACAGTAGCTGCATGCTccaaccttcttcaccagaCGCCCTAT
GCGCTTGATGTTCCCGTTGTTGTACGCCATGGTCGTTTGACCATGCGTGGTTTCATTGGCACCACGACGTTGTTCCTTGCGCTTCATGTCTTCATGCAGT
AGCCGAGACGTCACGAGTTTACACGTCAGTGTGTCGGCTCTTGACTCCAACACCGTGATCAGGAACTGGTACGATTCGCTCAATGTCTCAAGGAGCGTGA
TCACTAAGTCGTCCTCGGTGACCAGAGCGTCCACTGCATCAAAATGTTCCGCCAGGTCTTGACTTTATTGATGTGCTCCAACACATCATCACCTTCTTCC
ATCATTGTCGTGAAGAAACGTCGacgaaggaagagcttgtTCGCCAGGCTCCTCTTCTCGAAGTGTCCTTCAAGTTTCGAACATGCAGCATGCGCGCCAC
TCGCCGACAAGACCAGCGGCAGATGCGAATCCTCCATCACGAGACAGTCGATTGCCATCGCCTTGCGCGACTTATTCCGAAAGAGTTCTTGAtccgcctt
ggccttgcACTGTTCCAGCTTGATTCTCCACTTGTCGCTTCCCATAGTTCgcgctcctccagctccatccgCATCTTGAATTCCACGTGTGGAAGTTTGT
TCCGTCGAAGTTGTTGATGCGGGCGGTCGTGGTCGGCGTGGTATCCATGGCGAAGGCGTAGTCGGAGTCTTAGGCAGAGTCTGCGGGGCTTGGGCTCATA
ACCAATTGgaaggtcgcttgagcagttgttgataaaatgcaaagtgattgattagGTCCTTAGTCGCAAACCCTGTGCTACCTCTAAGCCTACTGGATTC
CCTACTGGATACACACTACTGGATTCTTCACTGGATACTGAGTTACTCCACCCAAtcagcgactgcaacgtAGAAACCCATACTGTACCCACAATTTTGT
ACCCATGCGTCTCGTAATATCCATCCTGTAATCGCAAGAATGATTGCAATACTGCTGACAGAAGGTAATACCAGTATCTAACCGTATACCGCAGCTAGTC
GAGACGCCTTCTTGACAACACAGACTTGCTCAACCACCCACGAGCCACTACATCTACACAAAATTCGTTTTAGACAATTTATTAAATAAAGAATATTATA
CCTTCAAGACGACGAAACTTGTCATAGAATCGTTTCTCCTGCTGTTTCTTAGGAGGTATGTGTCGCGGTTGATCGCCTTGCGCGTCTTGGgggccttctt
cttgccacaCACCTTGCAGTGCTTAGTCATATTCTACTTCGACATCAGCTTCTTGCACTAGCGCACACACCCTTCGAGGGCCCGTCGCCGTTTCCATTTC
ATACCAATTTCTAAGACTAAGACTGGGTGGTTTGTGTGTAACATGCATTTGTATTGGCTGTTTTAATGTTTTGCAATGTTATcatttgattggctgataa
AAGATGTGAACACCATCAACGATTACTGAGTAAATCTATCTGTATCCTACCAATTTTTGATGCCTCTGTCGAGAACGTTGGCTCGAGAAGTGTGATTGCT
CGATTATTGACGTCAGATAATCGGTACAATACAAGTTCTGATAAATCTACGTATAAGTAGATGCATCGATTTACTTACGTTTTTGCCAGCGCCTGCCAAT
AAGAGGGGATCGAACATGAAAATGGCTCCCAAATAACCCTAGACTGAATATCCACCCCTGGCTAGCATCTTCTTAATATCAGGGCAGCTTTGGCAGATAG
AGTCTGTAAGAGCAGGCGCCGGATAATCGTCTACAAGTTCCGATAAATCTACTTACGTTTTTACAAACGCCTGTCAATCTACTTGTTTTGATTAATTCCT
CGCTCATTTATGAACCAAATCACCCTCGGAGGTGGCTTATGTGAGAAATAAatcaaacttcaagttgttgtgcTTGCAATCCTCCGATGCCCTCCCAGTC
ACTTtccctcttcatcgtccacgAGCTTCCAAT