Description :
From Genome Similarity Track
Location :
Scaffold_690:3139- 4324
Sequence
1185 bases(100 bases per row)
GGGAATAATGTTAGACATGAGCACAGACAACTACAATAGATACGATGCAGCGCTTACGAGCAATAGAGTTCATGATGTTTGGCGACGCTGATACCAAGGT
AACTCTTGCAGTCGTCTGCGCTATCAGCAACATACTGACGAGCAGCGCAGTGCGCGAAGTTGTGCGTCGTTGACATCCAAGTGGCGCATTTGCAAACGTG
AAGGTTCCGCAGTGCTGATGAGCCTCCATTGCAGGAATGCCTTTCAGATCCAGTTTTGGCGTCTCTTGGCATCCGACCTGTCGGTATTTGATCAGCATGG
CCGTCGTCCATCGCATTGCCTTTTGCTGGGCCGATCCAGGAAATAGTCGTGTCTGTTGAACGAAGTGAAATCGATTTTGGACCGAATTGGAGTCTTCCCA
AGCACTTCAGCTCGGGTCTTCTATCGCATTGGAAACAACAATTCATACAGCGTCGTGATCTCCAAACCGGTCAAGCGCTGTCATCCAAACTGTGTGCTTC
CACCGCAAACTATCGCTTCCAAAATTCCTCAATCCGGCACCACCGCCATTTGCCTCCCGGGTATCACTGATACATGCCACCACTCCTCCACGACCGACTG
ATTTTTCGCTTGTGGTGGGAGACCTGCGCGACTTGATGTTGCCCGACGACGATAGCGATGGCGAAATCAATTCGGGGTACGAAGCCATACCAGACGCTTT
TAAAGCGGAACCGTCGCGCTCAAGACGATCATCTGTTCTTAAAAGAATGGTCTCTTGAATGTGGGTCTCCCACCGAGCAAGGCGACTAGCGTGGCTTGCC
ATCGTGGCCGGAAAGATCACACCTTCTTCACTTGGGTGGCGATGGTGCAGCTTGTTTCGAGGATAATGCTGGCGCTCACTACCCCCACCTGAAAAGCACG
CAGTGAGGTTTCAAGGCAATCACAGCTCATTAAGAATAGGGACTGTGACGGATCAAAAAGTAAGGTCATGTATGTTTTCGAACGACCATGAACCAATCAT
CCACACTGTATTTCCGAAAGTACTGAGCAGTCCTACCGCGTTTGATCCCGTTTGTAACTTCTGAATGCGTAAACGGGAACTCAATCGCTAGTCAGGATAA
ACTAAGTCAAAAATGAATGGTTCATAAGTTTGGTATAATCAGCAAGTGCATCCACAGTAATCACGCTGCTTCCACTAACAGGCAG