Description :
From Genome Similarity Track
Location :
Scaffold_157:31383- 32819
Transcript NameFunction/comments
Albla_Nc14086660

Sequence
1436 bases(100 bases per row)
AAAATGTTTGCGACATTCGTACTTGTGATTCGACGAGTGTCGTATCAGGAAATAGCGAGAGCTCTCAGTTGACTCGTGATTGTCCAGTAGTGCCTTCTCA
TTTCGCTCCATCCACTTTACAACGTTATTAGTGGGAGTTAGACTGGTCACATGAATGGCGTCTGCCATGCAGTCCTTGCTTGGATTGATATCTCCACAAT
TGTCAGAGCAGAGATTCGAATCAAGATTGAACTCCTGATTTGTGAAAAGTAAGATGAAAATCTCTGATTTTCTTTGTGGATCGCTTCAAATCTATTCAGA
AGTACCATTCCCTTGTATTTGGTGGCCAAGCAACCCCAACAACTGCCCCTGTCTCCGGAGTACTGTGCATAAGCCGTTGTCAGGCAGTACTTTATCATGT
TGATGTTAGAAAGCTGATTCTCGTACAAGACATATTGAGTTGTCTCCACTTGCTGCGCAGCATAAAGCTTGAATTCTGGCTGATTGATCCAGTTATTTTT
GGCATATTGCCAGAATTATCCACCGGTGCCGAAACTTTATACTTGAATAGCTTGCAAAGATTAGTTGAAAGTAAAGCGGTATATCCTCTGCAAAATTTCC
ATTTGTGACAAAACTTTAGCAAGGATTTTGAATCCGATGTTGTGATCACAAACAAAACACTATCGTCCTGTAATGTTTGCACCCAATATTTTTCCAATAT
GCTAGATCCGCTTTTCGATTGCAAACATGTTTCACATGAAGAGGCAGAAGACGAATCGGATTTATATAAGCACCTTTGCTCAGGTTCTCGGTCATTCCGT
TTTGAGCCTGACTGCCTCATGTGCTCAATATCAGCTGGGAGATCAGCTCGATGTTCCTCTGATACGCCGACTGGTGTTACCGAAAGTGTCTGCATAGCGC
TGACATCGTTTTCGATTGGATTGTTGATAGTTGGAACTTGTGGAAATATCCCATCATTGCCTTCAGTACTAATGTGTGCGTTTGTTTTCGTAATTATCAT
TTGATTGCATGCGGTCCGAGAAATGCATCTTATCAGATCAGCACCACCAAAGCTATTTGGTGACCCACAACCCAGTATTTCAAAGATTGCCTCCTTCGAT
GCGCTTTTTCCACCTCTTCTACATGAATGGCGCCTGCGTTTACCAATAAACAATTCTGCCACTGTTTATCCTGGTTTGTACTGACGGATACGGTAAACGA
ATCCAAGCTCTCAGCGTAACATCTAAAGCGCCAAAGGGCAACGAGTATGCAACGGAACAAACTCGCTTTCATCCAATAGCTAATTTATATCAATGCTGAC
GCTATTTGCACAAACGTCCGCAGGAGACAGTGTTATTCATACCCCTTCAGATTCCTTATTATACGATACACGATATGAAATATCAAATGATCCAAACCCT
GTACGATACACTTTCGATACGACCGAGCCAGACAAT