Description :
From Genome Similarity Track
Location :
Scaffold_29:31371- 38036
Transcript NameFunction/comments
Albla_Nc14031760callose synthase putative

Sequence
6665 bases(100 bases per row)
CGGCGTCGTGCGAGCTCTAATTATTTTGAATTAGATGCCGATCGCAGACGTACGAAATCGGGGCGTAAAGACCGTCTAAGTCACCGGGTGATGAGTCTTG
AAGTAGCTGATGCCAACGGAGATAGAAGGAATACTACCCCACAAAACGTCGTTGACCCGAACGCTGTCTTGGATGATGATGAAATCTCCATAGATTATTG
CTGTGACTTCCTTTACGCGAAATTCGGATTCCAAGAAGGTTCTGTCGCCAATCAACGGGAGCATGTATTATTGCTTCTAGCGAATGGTAAAGCTCGACAC
CATCCATCACAACCGTCCCATCATCACATAACACAACTACATGCCAAATTGGTCTCCAACTATGGAAGCTGGTGCGAATTTCTCCAAACCAGTCCGATCC
ATTATCAGGGAGCCATCAATGGTAAACTTCGGCATCCCTTACACATGGAAATCATGTTATATTTTCTCATTTGGGGTGAGAGCAGTAATTTACGTCATAT
GCCTGAATGTTTATGCTACATATTCCACCAACTTATGAGGCAATTAAATGAGGATCTCCAAGGACAAGACGGGAAGAAGGAAGGATGGTTTCTTCAAAAT
GTCGTTCAGCCGATTTGGGAAGAATGCAGCAACATGAAAAGACGTAACCACCTAAATAAACCGCTGGAACATGTCAAAGTACGAAATTATGACGATATTA
ATGAGTATTTCTGGAAGCCATATTGTCTGAAAATCGAGGTCACCCAAGTGGGTAACGAACTTGCCCAGAAACATGGGAAAACATTTTATGAACATCGAAG
CATTTTCACGCTCATCCTCAATTATTACCGAATATTCCAAGCCAATATTCTGTTTCTCACGATATTAGTTGTTTTAGCGTTCGCCGTTTCCATTTCACCG
AATGGTGGCCGAAGTGGATTTTCACAATTTCAAGCTTTGGGCGATACCATCGAACCGTTTGAAAAACGTGATTTGAAAATTGGATTTGTTGCCCTCCCGT
TTGTAACCTCACTTCTTGGTATTTGTAAGTGTGTGTTGGAATTTGCGCATTCATTTCACATTATTTTCTCTTCCGAGTCATCACTCACCTCATCACGATC
CTGGCCGTACACTATGGCACTTGCTGCACGTACATTGTGGCACACAGGGTTTATGGCATTATTTGCGTTCATGATCTATATCCCGTTACGGGATCAAAGT
GATACAAATTTGCTTCGGAATGCGTATGCAATCATGGCTGTCTATATCATCCCTGGACTTGTTACCCTTGCTGCCCAGACGTTTTATCCAAACTTGATTC
GAAAGACTTTTGCACTCAAATTTGTTCGTGAAGGCTCATCCTCGTATGTCGGTCGAGAAATGGCTCCACCATGGAAGTACAAAGTTCAATACGTTCTATT
TTGGATTGTCCTTTGGATTTGTAAAAGTTTTATCTCGTACACTATTCTGGTTCGGCCATTGATGCTTCCTTCCTTGGCGGTTTATGAGATGAAATTGACG
TATCAATCAGCGCTGGCCTCCTTCCACAACATCTTGGTTCTGGTATCGTATTGGGCGCCGACAGTTTTGATTTTCAATTATGACACACAGATTTATTTCA
CCATTCTCCAGTCGATTATCGGAGGATATATGGGCTGGCGAATGAAGACGGGCGAAATCAGAGGATCAAAAGAATTGACTAGAGCCTTTCGGGTCGCACC
TCAGCTGTTTGATCAGAAAATCGTTACGAATTTGGCACGATCCAGTGATTTGGTTCAGTCTCTCAATCCTAAAGACAGTAAAACATCCGTAAATGCCGCC
ACTTATGAAAGTCAAATGATGCTTAGATTTGTGGTTGTATGGAATGAAATTGTCAATTCCTTCCGTGAAGGCGATTTGCTTGATGATAAAGAAGCAGCCA
TTCTCCAGTACGATATCCGAAGCAATGGCGAAGTGTTTGAACCAGTCTTTCTCTCGGCTGGTAAATTAGGAGAGGCCATCACAAAAACAATTCGCAACAG
TAAAGATGGAAAAAGCGAGTCTCAATTACAAGTCAGCTTGGTGGAAGGTGATTGCATTTCGGCAATTCGGAGTTTTTTCACTGCGTGTATGTACGTGATG
GAGGCTTTATTTGGAATGGAAGATGGAAATGTACTCAATGGTTTGCGAATGATGGAAGAAATTGTTGAGAATCGAGCCACTATGCGCTCCTTCCAGTTTC
AAGAACTCGCTCGCTTACGTCTGGCGGCGCTGGACATCTTGGAAGAAATTCTAGACTTACCAGACCCAAGCACAGTCTCTGCTCATTCGCCGGATACTTT
TATTCACACACTTGGCACTATCAGAAATTTCGTGAACAAAGTGGAAGTACTGCTCAACTCTCTGCAAGCATTCTCAGAAGCTCCGGAATTGAAGGGGAAA
TTCGTCAATACGAAATTCTGCTCCAGTCCAAATGGATACATGCATGCCGCTCAAGGTCTCGTAAACCTTTATCGCAGCGATGTCGCAATGGGTGCCGCAA
CTCGAGCGTGTTTACTGCTGTCTTTGGACCGGTCTGAAGCGATGCCGAGATGCATGGAAGCACAACGTCGTCTGGGATTCTTTATGCGCTCACTGGTAAT
GGAAATTCCTCAGTTGAACGCTATCAAAGAGATGCGATCATTTTCGGTTGTGACTCCGTTCTATGCCGAAACTGTTCTCTTCTCTCTCAAAGAATTGAAC
GATCCGTTGGTCAACCATCCAATTTTTCAAAAAGTGGAAGAAGGTGGCAAGAACTTGACAATTTTGAAGTATTTGAATAAAATTCACCCTGAAGAATGGG
AGAATTTTCTGGAGCGCGTGGATGTTGCCAGCGCTGAGGAAGCACAAGAGCGATATCCACAAGAGATCAGATTATGGGCTTCCTACCGTGGGCAAACTTT
GGCTCGTACGGTGCAGGGTATGATGCTGTACGAAGACGCTATCAAAATTCTCCACTGGCTGGAAATTGGGTCGAACTCAGCGCGTACGGCGGAAGAAAAG
CAAACGCAACTACAAGACATGGTACGGCTCAAGTTTTCCTACATTTGTGCTTGTCAAGTGTATGGCAAACACCGTCGTGAAAACAAGCAACAAGCCGACG
ATATTGATTATCTCTTACAAGAGTATCCCAATCTCCGTGTCGCTTACGTTGACACGATCGAGTCGGGTGAGAATGAATTCGTGTACGATACAGTCTTGAT
TAAAAGCGAACAGAACGAAATTGTCGAAGTGTATCGGTACCAATTACCAGGCGACCCGATTATTGGTGAAGGGAAGCCCGAGAATCAAAACAATGCAATG
CAATTCACACGTGGAGAATTTGTGCAGACCATAGATATGAACCAGCAACACTACTTTGAAGAGTGCTTGAAGATGCCTCAATTGCTCCGAACGGCCGAAC
TGCATTCTTCTGGAAAAGCTGTTTCTATCATCGGGATGCGAGAACATATCTTTACCGGGAATGCTTCATCATTAGCCAAGTTCAAAACCTGGCAGGAACT
CGTGTTTGTCACGCTCTCCCAACGCGTTTTGGCCGATCCACTCTACGTACGAATGCATTACGGTCATCCAGATATATTTGACAAAGTTCTGGCACTCACT
CGAGGTGGTGTGTCCAAAGCAAGCAAGGGGATCAATCTATCGGAAGATGTGTTTGCCGGGTTTAACGCAACTTTACGCGGAGGCGTAGTCACGCACGTGG
AATTTATGCAGTGTGGTAAAGGGCGTGATGTCGCTCTTTCACAAATTTCCATGTTTGAAGGAAAACTTGCTAATGGAGCGGGTGAAACTTCCTTGGCTCG
TGAGGCTCATCGTATGGGTCAATTCATGGACTTTTTTCGCCTCAATTCCATGTACTACTCGCACACAGGCTTCTTTTTTGCGACGTGGATGACCGTTGTT
ACGACGTTTGTGTACATGTATTGCAAGGTTTACATCGTGCTAGTGGGTGTCCAGGATCAGATCATCTTTCAGATGAACGAAACAATCATTCTGTCGCAAA
ATTATCGGTACGGCATACCCAGCCGCGCATACGACGACACTAATGCGATCGTGAATACTCAGTATTACATCCAAGCCGGGTTGTTTCTCTCGCTTCCTCT
CGTGGTTGTCTACTTTAGCGAAATGGGAGTATACCGGGGTTTCTTCCGTCTTATTGAGATGGTAATCACCGGTGGGCCTTTTTTCTTCATTTTCCAAGTC
GGAACGACTATGCATTACTTTGACAACAACTTGGTGCATGGAGAAGCGCAATACAAAGCTACTGGTCGTGGGTTCAAAATCACAAGAGAGCTGTTTGTCC
TACTATACAAGGCCTATGCCAGCTCTCATTATCGAAAAGCATTCGAGCTTACTGGGTTGTGCTTGATCTATCTGACGTACGGAGACTTCAACATTTGTGG
GCCGCCTCCGTCTGCCGATGGCAATTCGTTCTCATTCGATTTTTGTACCACAGCTCAGAGCTTTTGGGTCCAAACGTTTGCCATTTGGTTCATTGCAATT
ACATGGTTTATTGCTCCATATATCTTCAATACTGACGGTTTGGACTTCCAGAAAACAAAAGCCGATATTCAGGCCTGGGCGACTTGGATGTACGCTGATG
AGAATTATGAGGATGAGGACTCTACAATGAACGGTGGATGGATCGGCTGGTGGAAAAGTGAGCTCAAACTATTTCATAATTCCAAACCAATCGCTCGTTT
GACTATTATCCTGCGCGAGAGTCGACACTTTATATTAATGTGGTATGTGGTGACGCTGAAATGGAATCTACTGACCATTGCGTATGTATTTGGCGCTGGT
GTGATCTCCATTTTGCTTCTCAACGTGATGAGTCTATTACGAGTGGCATTTCGACGGTGCAGTCCGACTCCACGCGCCTTAATCTACGTCTCGGCAGTTT
GTGTTGCGATCACAGCATACTTCACCGTCACTAGCTACATTTTCAAGACGGATTTCCAGGAAGCTGCATCTTTATTCTACGGCTATATCGCCGTTCTTTA
TGGAATCAATGAGATGGCTCGCATGTACAGCTTCCAGTCGACTTCCATTGCAAATACCACAATATTCCAAGAGTTGGCCTTTTTTTTCGACTTTACGATC
TGTTTCATCATGATTGTCCCGCTGTTTATCATGTCTGGAATTCCATTCTTGAACATCGTGCAAACGAGAATGATGTATAACAAAGGTTTCTCGCAGATCG
TTTCAGCCTCATCTCAATATGCGTTCTCCTTGGCAGCTTTCCTCGGTGTTGTGGGAGGCAGTGGCTGTGGATGGATAATTTACGTCATGTCTGTCCTGGA
AAGCAGCCCAGGGTTTATCAGCTACGCGACCAATTATGATCTTCTGGACAATAAAGCAGGAGATGGAACGACAACCTACTTCTTCTATTTCGCAGCCGTA
ATGGCTGCTGTCTTGGGTGGATTCTTCAATTTCTTTTTCGGAAGACGTCTGACGGTTGTTTGTGGAGGCATGTTATCAGCTCTCGCGATGGTATTGATTA
GCGCGGTCACCACACAAGGAGAGAGCTTATTATTTCCTGGAACGGCGTTATTGGGTGCCTCTATAGGGATCCTACTACCGAGTATCGCTATTTACATTTA
CGAAATCTCCACACGCGAACTTCGAGCCAAGTCGATGCTGTTGCTCGGAACTGGTTTCATCATTGGTACAATGTTGGGGTCCATCTTCATGTCTCCCGAA
GAAGAAATCGGCTGGATTTGGCAGCTCTTCATTGCAAATATCTTGCTTTCAGTGGTGACACCAGTTGTGTTTTTGTTTCCCGAAAGCGCTTACTGGATCT
ATATGCGGGAAGGAGCGGATTCTTGTGAGCGGTGTCTCACTGTTCTCCGTCGAAAGGAAGGTGTTCAGGACGAACTTCAGCTTATTCGCGAGGAATCGAC
TTTAGCAAACAAATGCACCGGTAATGTTTTCAAGTTTGGACTCGGATTGTGCCTCATGGTCGTCTCCAGTCTCGCGAATGGAGCGCTAGTTATCTACCTG
ACAACCGCTTTGGCCACGTCAGGTTCCTCCGCATCAAACTTTACCAACTGCGTGATTCTGCAGCTTGTGGGTGCCCTACTTTCATTCTTCGTCATTGATC
GAGTGGATTTACGTCGGGTGTTGCTGGGAACGCTAATACCGATAACATTCTTTGTCACGTTGCTGGGCTTCAACGCCAACACAAACACTTGGACTGGGGA
CGCAAACAACATTTTTTTACAAATAGTTGGATGCTTACTATACTTTTTCCTTGGGCTTGGAACGTCGACGGCATTGTGGGCCTCTGCAGTTGGCTTATTT
CCGACCAAACAGCGAGCTCTGTACACTACCTTTTACTTTATGATCTTCTTTCTCATTCCGATTATGGCACTGTACATCCGCTCATCACCGTCTTTATATC
GGTCGGCAGAATATGTGTATTTGTACATTTTGGCTGGCGTGTGCATCGTGTCCACCATCTTCTTATTTGTGGCGGGGCACTTATCAAATGGTCTCATTGG
CACCAGGCAAGAGCAGGAAGCCGAGGAAGCTCAAGCTCGACGTGCCCGGGCCTCACGACAGAGCTCCAGACTAACACCCGGTGGACGTATGCGTTATATC
AACCGATCTCGTGACAAGTCTTACAACAGCAGCGGGTACCAATTGTATGAGTCCCCGGCCGCTGG