Description :
From Genome Similarity Track
Location :
scaffold_20:313537- 316910
Sequence
3373 bases(100 bases per row)
TGACCAAATGCTGCGACTCTGGGAAAAAGTCGACGTCCACACCTTACCGAGAATCCACACAAAGACAAGCTGCAAAAGATCGTCCTTCGTGGGCACTGCT
TAAAGAGCAAGAGTGGCACATTTCCACGCAGTGCAAGTGGAAATAGGAGATATTGGAATTATCTTGTGAAATAGAAAAGATACCCCCGCTGCAAAAACAA
GTGGGGAGGTTAAAGTCCTCTTTCGGCCTGATTACCCTGGTGCCTTTGCCGCTTATAAATTGGCGCTCCCTCGATCACATTTATATTGACTATTAGAAGT
ATATTATAATGTCTTTTCAGCTCAACCGGGAACGTTCGACTGTACCGTAAACGCAATTAGGTCTCGGAGACAGCACAAAATGCATGTTAATCAGGTTGAG
ATTATTCATGAAAAACCATTGCGTTTTTCGGTACGTTTCGTTTTCTGGCATCGGCAAGTTGATATTGTCGATCACTCGACGCATGACACTAAATTTATTG
GGTAAAATATAATAATTGATGAAATGAGTAGCCAGACCGATATCAAAAAGTCGAACGGTACCGACACCTAAACCGGAAATACTTTGTGGCGCTGTGTATG
GGACATATTAGTTAATCAACCATCTAAAAATCAAGTGTAAACTCTCGAGATTCGGGTTAGCGCGGGGTATTCAGTATAGCACCGCGGAGTCTTTGCGCAA
GTGCTTTGGATTTTTTTTAGCTCGCAATCAGCCGGACACGTCTAATCATCTATCTCCGAGTGGTGGGCGGCGCGTCTCTGTACTGATCAGTTCAAGAAGG
ATGTCAATTGATGCTGGAGTGCTGTAAAAAAGATGGTTTTTAGATTGTGCCATAAAATTTTTCATAAGTTCCTCAAATCTATACCTTTGGTCATCGTATG
TCATCTGTCACATTAGCGTAATTGCTATAGGCTCGGTGTTACTCCAAGAAGATGCCAATGAATATCATCACGTTTGAGTCTTGCCAGCTGAACGCAGCAG
GGATCGCCCATTTTGCTCATGAGCTGTTTGCAATATAGTATGCAACCCAAGCTTAGCGTGCACCAGATTCGCTTcaagtcgtttgtgatcgaaACAGATC
TTGTGACATTGCGAATAGCGACGACGTGACATCAAGAATGGCATTATATTTATCTCTGAAAAATCATGTATTGAACTAAGTTAGCCATATGTGATAATAG
TGCGCTTTCGCGTCTCCCCGGCTATGGAATGTGCGTGTCACGATGGTGGCGCTGAAATTCGATGAGGCTATACGTACAGCGTACGGATCAGAAGCAACAT
ATGTGGCGTAGTAACAAACCTTGAGAATTAAATTTTGCGAGTTGAGAAGCCGCTTTGTCAAAGCGTTCAGTTGCACCTTTGCCCTATTTAACCTTTTCTC
AATGCTTACTTCGTTACAGCGCAGACCCATAAGACATCCAACGAGTGCTGGTACTTCGTGACGTAAATTTCAAGTACATAACCGCTCGAGATACACCAGG
CGCCTACCTCCAAAGAGAAGCGATGTATATCTGAGCAAACATTAAATATTGGTGGACTAAAAATGTATACCTGGATAGAcacttatgtgcgcacgcgCGA
AGATGCCGAGTAGTGAACACTCGCTACATAAGTCAGCTTCGGCAAGTATACCAGATTTGCACAGTTTTGGAAGCTCATAAGTGTGAGCTTTTTAGCAGAT
TCCCCATCTCTCCGCTGTCAGCGGCAGTGCTACCGGTGTGTTGATAGCCAAGGTTTCTCTGACTAAAGTGTTTGCCTAGTTTTGATGGTGAGATGTTTAT
GGATCAAGATACATACCTAGCAGCGTGTCAATATCAAGGTGCTGAGGTCATATTGAGGATACCAATCACTTaccatccgcagacagaTGGTCAGATAGAA
CGCGTTCGTCgcatgatgaagatttttCTTCAGAGGCCATACGTGGAGCGATCGCGGTACTGGGGAGAATCATTCCAATCCGACCTCGAAGTGAGTATGG
TATTGGTGGGGGGGGGTACGTCTTTGATTTTATTCGACTTGCTGGTATTCGATCGGCTAGACATCTTAGCAAAATAGGCAGTTCCATCGACATAAATTGA
ATGTCAAGCGCCAAGTGCGCAACGCCATAGACAAGGGCCAAGATGAAGTCGATTGTCAAGCGCCGAGTGCGCAACGCTATAGCCAAAGGCCAGGACGTAG
TAGAGCACCCAATCGATGACAGTAGACTTATAAGGTAAGATTTTATCGGATACTGTACACCTACCTACACAGACAGTGTCTGCATTCTATACAACATATA
TTTTGGTCCCGCTACATCAAAGCCTTTGCGGTTGTAGCAAGAAAACGAATGATATACACTATTTGCTTCTTTTAGAGGTGTTTTTTTTCTACGTTGGCTT
TTGAAGCTACATTaacatttcatttttttgtttgtctAGCTCTCTTAAAGACGAAACAATGTATCACGCCTTCCTTTTTCAGCGTCTTCTGCGTCAGGCC
TACGACACGATTCTGTATCTCATAGAAGCCACAAGCCACGCGTTACCACGAcatagctcaaaaaggatCCCTGATTGTATCCAGATTCAAAATCGCCCGC
AAGCCGAGACTCTCTAAAAAAGTCAACGTGCTGTCATCATCAAGAATGCAAACACAAATCGTTGATGGGCGAGAGAAGGATTTCATCCATGCGGAACGTA
TAGTGCACCGGCGGGATCACCAAGGCGGAATCCAGCCAGTGCGTGACGAATGATTTGGTGAGGATAACATTCCCTCACCTCAAAATTCGTTGAAGATTGA
TTAGTCATTCACAAGATTGCGCTGGCGCCATTGCCATTTATGTCTTAGCACACTTTCCCTTCGAAGAAGATGCAAGTTCGCCCAGCGAAACGAGCTTGCC
TCTAGAGTGTTACATCAAGGCTGCTCAAAATTTTAAGTTTGGTAACTAAATGAACTAGCAGGATCGTGATGCTGAACACGGTGATCATTCGCAAGGAATA
TATGGTTATTATCTTCCTTAGCTTCCATGCTGTGACAAAGTCAAGCGGTGAAAAACACCCTAGCCTTGCGTTTATTTTTACAGAAACAAGCTTATGAGGC
TGATTCATAGTCAGGGAACACAATTTCCCGGTCGCTGCTGCACCAGTACTCTAAAGAAATCGTGACCTGAGGGGTGAGAACCGTTTGCTGAGCACTGTCA
AGCGCTCGTTTAGCACAAATCCCAGCACGCATAGACGTGTCAGGGGTCTGCATCCGCGCGGCTAGCGGCTTTTCAATTACATAATCACGACGTTGTTGGg
tctgcaaattttgctctaACCCTGGCGCCTGCAAACGTACAAGCTTCGCTCACTGAGCCAGTTCAACTTCTCA