Description :
From Genome Similarity Track
Location :
Scaffold_1761:3135- 5148
Transcript NameFunction/comments
Phypl_g14098hypothetical protein

Sequence
2013 bases(100 bases per row)
GCTCACGCGGGTTGTTAGTGCGTGCAACAacgttgttgctgtagccATGCACATCCCAAAACTGTGGCGgcaacagcttcagccaCGTGCGATCGAAGTA
CTTTCAAAACGAATCCCATTTTGTACTCGAGTAGGTGATGTTGTCCTTGTTGCATCACTCCTGAATAGCGCCCTAGACCCAAGTAATGCCCTGCGGCGCG
ATCTTGGTTCTGTCGATCACGGTGAGCATGTCCAGAAATTCTGGTAGCATCGCAACCTTCACTGGGTCTTTGTGCAAGCGATATTTCAGCATTCGACGCT
TGCATGCTTGTTTGAAATGGAACAAGCACATGATGATTGCTGCTTGAGGAAACCAGTCGCTCGCGGCGTTGATAAGGGCAGCTTCGAAATCGCACACGGC
ATCTTTGGGCTTGAGAACCTCCCTGCACGCATTGGAGACAAACTGGAGCAAGTTCTAGTACGTGTCGTAGTTCCTGAATGAACAaagcacgaagaagacc
ggGATGTAGAGCTTGGTAACTCGATCGTAGACCATTATCATGACGCACTGTCCAAAGTTGTCTGGCACACAGCGGAATGTGCCATCCGCAAAGAGCGTGA
TGTTCTCGTACCGACGTAAATTCAGTAGAGAGGGGTTCGGTCAGCCGATCACCCGGTCCAACTCGCTATTCGGATTGGTGGAAATGCAAAAAAAATCAAG
TTGCTATTCTTGACGTTCACCAACGGCGGGGTTTCGGCTCGACCGTGAACGTCCGTTCCGTAGTGTAGCGCTCGTGTGTGGTGGACTCGCTTAATGACTT
GACCTCTAGTCATTCCACGGACTGCAGTGCTGTTCTCGGTCGTCCTGTAGTACTTGGAGCTAGTCTCACCCCAGATCTGGAGTGGCGTTGGTACCGTAGA
TGCCGCCATATTGTCGACTTCACGCTTCATTGCTGCCGTGACATCGAGCGCCCCAGTCTCATCGCGGTCTGTAAGCGCTCGAAGAGATGTCGGGATGCAG
GTGCGTGCGATGCGGTTGGCGAAATCATAGTCCATTACCGCAGCGATTAACGCAACCTTGGCTTGGCAGCTCTGGCTACGATAAAAACTGCATCGGTATG
TTATCTTGACCTGCGTACAGGTAGCACGCGTCTACGCATAACCGTTGAGATACAACTTCGTCCTTCCATCACGCTTTTTGCGTGCTGGTGCATCGCCACG
CGTAGTTGAAGACACCGAAGCGGAGCGCTGCCGCTTGGTGGACAACGAGCTATGTCAACGCCTGAGTCCCACGGCGCGTCGTCCGTACTTGACAAAAact
cgtcttcctctcctTCAACGTCGACGGCACTGCTGCTAGCCGTACCGTCACGCTCAGCTTCATCAAGGGAATCGACGCTCGCTTCATTTGCTAGGTGGTG
GGTGTGACCGCGGGGGTcttcgccaccagcagcatctggTACGTCGTTACTGCCGTCCCTGCTAAGACTGcgcccacgcgctccaccttCCGCAACTTCC
GCAGCATCACGACGAAGAGTAATGCGGCGGGGGACGCGCCTACGAGCACCATctctcgcagcagcatcactCCCGATAGTGGGGCGGCGAGTTCGCACAC
GGCCACCAGTCCCCGGCAGCGGCTACAGCAATGCCTTGCTGGTGAGTGCGCCCACGCgcacctcctcctgctccaggtGCAATATCGTCGTCACCACGAT
GGCTCACCGCCGACGCCCCACAGCAAGTAAGACGCGCGACGACCGTGCAAACGGACAAGGAAGCGCTCCTGCACGTGGGCGCATCCACCACAATGCCGAC
GTTGCTGTCCCTGCTGAAGGCCTCCGTGCGCGCACCCCCAGCCTAGAACGTCGGTTTGGTTCTTCAAAAAGAAAAGTAGCAAACGAATGGAATCGATGAT
ACCAAAGTAGATTCTAAACAAAACCTTAAGACCTACACATGTGATCTCTTAGAAAAACAATATCTGACCTTGAGGTGACCTGATCCTCTCATGATCTGTA
ATGGGTCCTTCGG