Description :
From Genome Similarity Track
Location :
Scaffold_3:313401- 317022
Transcript NameFunction/comments
Physo_127877gag protein

Sequence
3621 bases(100 bases per row)
CCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTTCGCGGGTAGATTGGACTACCTGAATCCT
CTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCTCCATCTGAACGACTCGCAGTTCGAGTCCGTTCGTAAGATGGCAGGCATCTTTGGG
ACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTC
AAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCA
CTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCT
AAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCTCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACT
ACGAGTACCGGCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGGGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGT
GGAGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACT
ATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTG
CGCCTAATGGTAACTCCGGCAATGGAGCGATCCACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGACTGTGGCAA
GCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCACCCA
AGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGACTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGA
CTTAGCCCCTGAGAGGCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGA
ATCTTGATGGACTCTGGGGCGTCCAACAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGTAAAGGCA
ACGGACTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGGTAAGTTAGAGGACTTCGACAGCACGGA
GCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATC
GGGTCCAGCCATCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGTAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAG
CGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGG
TAACGTAGGTCTACACACGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTAGGTAACCATGTTCCACGCGCG
GTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCTGATGTGGGTAACATAGGCCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAG
CCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAA
CAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGAC
GAAGATACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCG
AAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCT
TGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGATTCCACGTCGGCCGCGTTGAAC
TCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCCCGTCGCGCATGGACTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGT
ACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGG
CACGAAGTACTGTGTCACGAGGCAATGGGCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGG
GAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAATGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAG
TGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTATGC
GCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTT
CAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGTCGTACTTTGACGGCATCCTCGTCCACAGCCGTGCCGAGGCAGGCCAGACG
GCCATGGAGGTGATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGA
GATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAG
GACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATG
TCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCC
TTTCAGCGTAGTCTGTGATGC