Description :
From Genome Similarity Track
Location :
contig_97:31340- 33106
Transcript NameFunction/comments
g13349.t1ETP17396.1 hypothetical protein F441_08194 [Phytophthora parasitica CJ01A1

Sequence
1766 bases(100 bases per row)
TCCGGAGGTGGATGTCTTCTGAACACAACCGGACATAACTGGACACCACTGTACACAACTGGCCATAACTGGACACACCCGCAATCTTTCCATCGCGATT
CCTCCAAACGCGATCTCATGCCATCAGTCCCTTCCGAATCGCTCAATCTCTCCAACTGACAAGTCGCTTCACCTCAAGTGCAACTAGATCCTTTCGAAGC
TCGACGCCAATGCACGTTCTAACGCTCGTCGCAAGTGCAACTTGAGCGACAATGTTGCCCACACCAGCTCCAACATCGAGGAAAACGTCGGCTTCTCCGA
GGGGTCCAACAGCTTCAAGTATCTTTGAGACACCCGACGGTAACACCTCACCAGCATTGCCATAAGTACGGCCGGCTTGCTGGCGGACATCGTGCGCACT
GATTCCTGCAAATATGAGATTCACAGCTTTCGCTGCTTGCCCTGGGTTGAGTATAGTTTCACGTGACTCAGCGGCGACGCAGCCCGCGAAGGTGGTACTG
CCCACAGACTTGAATATGGTGTGGCTCACCGGCTCGGACGTGGTGTTGACCGCAGACGTGGCTACGGCGGCGATCCCGACACGGTCACCAGCCTCGGCGG
AGAGGCTGGGCATGGTAACGGAGCCGCGCACGGACTTGGTGGCAGCGCGGTCTGAAGCCTTGGCCTTGACGTCCATGGCGGCACGGACACCAGACTCCGC
TGCGAGGCAGCTGGTGACGGCGGTGTCACGGACAGACTTAGTGCGCATGACCTCGGTGTCGGTGCTGCTCGCGGGCTGGTTGGGGCTGTTGCTCGCGGAC
TTGAAGGAGGACCCGGTGTCGGTGCCAATGGCAACACCACCGCCTGATCCGTTGGAAAGACTAGCCGAGGTTGTGGTGGAGGGCGTGAGGCCGAGACGGG
GAGGTGGTGCGTGCGTCGGCGCTATTAGTCGCCGGGAAATGGGGAGAGATGGCGGCGGCCGAGCTCGCGCGACTAGAACTCCCCTGGAAGGCAGACCACT
GAAAAAGCACCGCGGAAAGCTGCTTATGGTCTTCCCGTACGTCCTCTTGAGACTGGCCAGCCGAAGACGGAGCTCGTTCGCAGAGCGCTTGGTTTTCATC
CGACGGGCCACATATGCCCAGGTGATGCGAAGGCCTTCCCTCTCGAACTGAAGTGTGATCTGGACCAGTAGCTTGTCTTCTTTGTCAGTGAAACTTGTGC
GCATTTCTGCTAATTTTTGTATGTGAAATGAAGTCAGCATGTAGTGCATTTGACTTACCTTATGTATGGCGATATGACTGGCTGCACGGTGATACTGGTG
CTCATTGTTTTTGCAGCGCTTGGTCGATGACGCGGCGGTGCGGCTGCGACCGATTACGGCGGCTGAAGCAATAAAATACACCTCGGAGACGCGAGCATTT
GAAAAATACCCCCATCCCTCTTAAACAAAATGCTGTGATTGGTAGTAATATTACACGGTAGGTCGAGCGCGGGATTAGGCTAAAAGGGCGCAACAATCGC
CCTTTTAGAAGTCCATTTGTCACCGTGTTTTGGAAACAGCGTTAAAGGGCGAGAAATGCGCCCTTGCACCGCGAAAGGGTTAATTAATTAGCTAAGTTCG
CTTTCGTTAATTTGCTTAAGTTCCGACTTGCTTGAATATTTTTTTCTTACGAGCACGAATTTCCGTTCGATGCTTCTCATCATATTCTCGCTGCTTCGCC
AGTCGCGTTTCCCTTGTCTTTAGATAGTAGCGCCTTGATGCGCTCTTTATTAACCCCCCCAACGCG