Description :
From Genome Similarity Track
Location :
Scaffold_481:3134- 4834
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_481-snap-gene-0.8Proteasome 26S non-ATPase subunit 5

Sequence
1700 bases(100 bases per row)
CCAGTCGGGTAAACCTTGCCTTTCATTTGCCGAGCTGTGTACCTGTGGTGATGTTTTGAGGAGCTAATGATTATTTTGTGGAGCAGGAACTCTTCAGACA
CTGCTTGGAATGGCAGAAGGTAAAGGCTTGAATGTGCACAATCATGTGTGAATCGAACGAATATGATTGTTAACTGGTTGTTTGTTTGTCTAAAACTCAA
TCAGACCCATTCGTTGGAGGAAGCGCGATTCGTCTGATCGGCGAGATGTCTGCCACTGCAGCAAAGCTGAATGTCAAGTCGTGGAATTGGGACGACCCTG
TGCTGTCGAAGGCGTTTTTGGAGACGATCGAGAACAAGATTCAGAGCACCGACTCGTTGCAGCAAATCGCGGCGATGGACTCGCTTGCTGCTTTTGGCTC
GTCGTCTGACAAAGGTATGATTGTATCAACTTGTGACGTGATGTGAATTTGTTTTATGGATCTAACCAAGTGGTAATGGGTGCTTGTATGTGTTAGAATT
GCACCTCTTGCTGCAGCACAAGAACTTGTGCCAGTCGTGGCTTCGGCTTGGAGCGAGCACAAAAATGGAAGTGAAGGCAAATTGTTTTCACTCGTTGGCT
CGAATCATCGGAGAACCCACACGTTTGACGCGTACATCAGAAGAGATCCCGGCGGAAAATGCGGGTGTTTGGATGCTTCACGAGCGTCTCTTTAACAGTC
TCGGTCGGGAGTGCCGCAACCAGTCCACGCTTTTGTACCTGATGGAAATTTTGAGACAGCCATTTGAGGAGATCCGCAGCGCAGTATTCGTGTTGCTGCG
CGCTGTCGCTGCTCAGAACAACGAGTGGGGCATGTGCGCGCTGCTTTCCTACGGCGGCTTCTTTGAGTTCCTCGTGGATCGCACGACTGAGCCAACGAAG
GAGACCCGCGAGTGGAAGTTTTCTGTCGCGGATGCAGTGATGGTCTCTCCGTTCCGCTCGAAACTGGGTTCGTGCTGGGTTGTTGTTTTGTTCGTTGAAA
GTTTCGCTTTGCTTATTTTTTCTTCTTCTGTGCTGGGGATATATTGCAGATGCTGTGACACTGGAGAAATTGCAAGCCTACTTGCACAACGGTCCGTACG
CGGGCGTCGCGCCTCCGTCGATGGACCTTGACGCGGCATAAGGCAGCGAGCGAGTGATGCCAACCGTCCAACAGATCGGTAAGTGAGGGCTTGGCGTGGA
AGTGGAAGCTGTGACGCCCAAGCGTGATGTATCAACAAGTGAAGCCTTGGTGCATATATGTGGAAGGAAAGGATTTTCTGGAGTTTAATTTTGGACCTCG
ATGTTCATTCAGCAATGATCACTTTTGGATTTGATTTCACGAAATGTGTCCCAAGTAAAATCAGAAAACGATGCATGCTCGCTTGCAATGTGGCGGCATT
CACAAACAGCTCTTGAGAAATTATGTGTGGTGTGTACACACAACGTTTTCAGCTACGTTTGATAGAATGTACAAACAAATACCCGTCAAATACTATCCCC
TTGTTTTACCGATACTTGGAGCGACTCATTCGGGACGCTCGGGACAGGGCGGGATAGCTTGACGATTGCCGCGCGACAACACAAAAAGCACGCGGGGGAA
AGCGAGGCGGCAATCAGCATCAGTGCGTCAGTCGGTCGGCCGATTGTAAAGATTAGGCGCAACACCAAGACACACACACACGCTGCGAGCGAGCGAGCGA