Description :
From Genome Similarity Track
Location :
scaffold_12:31334- 40887
Transcript NameFunction/comments
g747.t1hypothetical protein
g748.t1 hypothetical protein PHYSODRAFT_552331
g749.t1 hypothetical protein PHYSODRAFT_472033

Sequence
9553 bases(100 bases per row)
AGTGAATACGGCTTTCGCTGTAGCTCTTAGCGCACCAACCACAGCGAATACGGCGCCGAAACTTGGTACGAAGACGATATACATTTTCGTGAGCCACATG
GGCTTGGTTGCGAGGCGGAGACGCGCATGCAGGGATCACACGACCGGGATATCTTCACTAGGAAACAGTTTACCAGCAAAAGTATTATTTTCTACTGATT
TTAGTACTATTTCAAATTCACAAAGTAGTAATGATAATATGAGTCCAAAATTGAGAATACTTGTTTTAAAAATATAGTTGTAATGATATTTGAGTGATAT
AGTTTTTTTGGACCAAAATACAATTGTGTCCCATACAAACTTCAAATCAAAGGGACTAAATACTGTGTGCAAGTTTCACCAACCGTTCGACACTAATAGG
AGGATGGCTCGGTCGGCAAGCAGCCGCCACCAGCCTCTTTAACTCACATGCCGTTCATATACTCAGCAACAAAAAGTGGCATCACGCGTTTATACAGCTG
CAGTTTACATTTTATCTCTGAAACACAGGTTTCCAATTCACGATTCTTCGCAGAGGTATCAGTCGCTAAGGTCGGACTCGTCCTCGTCCGACTCAAAGGC
GGCTGCGGTTGCGAGACCAAAGAGAAGTGGTGCAGGCTTCTTCACTGTCTTGATCACGGAAACTTTGTCAGGGACCTCCATTGTTTGGGTATCTCCCCAC
GTCACAGACTTTCGACGGGTCGTGCTGGTGCGTGATGACGGGGACAAACGCTCTCCGAACAAGCTTTCTGCTTCGTCGAAGCTGTGCACCGAGGAGGCCG
GAGAGGTTGATGCAGCAGGAATTCCAGCCTGCAGTGATTTTTGTTTCTTCTGAGAGATGGGCCTGAAAGTCTCCCCGAATAGGTCTGCAGGTTTACAACC
TTCTTCGGTTTTGATGGGGGTTTCCAATTCAGCGGATCTCGTCGGAACTGGGGTAGAAGTATTTTTTTGCACGATTGGGGCCGTTGTTGGAATTCTACTG
GGAGTGCTAACAGCAATGTTTAGCAACGGTGGCGGGGTTTCGGCGTGTTTCATCACTTGAGATTCAGGCATCGGTTCTACCGTATTGGCCTTTGTCACCA
CTTCTTCATTGACTTTTTGTTGGACAGGCTCAGTCATCAATGCTGGTACAACCGTAAGAGCAGGAGGTTGAATAACTGGAGAAGCAGTTTTGGAGAAGGC
AGTGCCAAGCTGTACAAGATCACTGACAGCATGGCCACTTGTCGGGTAAACCACGTCGTTTGCCGAGAGAGTCGTTTTTGTACTAGCGATGGAAGCTGCT
TCAGTCGAGGTCCCGTCACAGGCTGCAACAGTTGCGGGTATCACCTCGTTATCAGGATTTGCATTAACGGTGGCGATCTTCTTCGAGCTCAATAGCTGTA
CTCTCTGGAGTTCACGTTTCATCTCATCTTTGTTTCGTAGCAAATAGTTTTTGGCTGTGAGGAGTAGAGCTTTGCTTTTCACCAAGTTTGGTTGGATGCT
AAGCAAGCAAGGCACCAGATGCAACGCACGAATAGATCCGAAGTCCTTGATAAGCGTATCCAAGTAAGCACTTGAGTCCAAGAAATCGGTCCCAAATAGC
CGTGAGTTCACCTTGAATTCCTCTAATCGCACCCTGTCTTTCTTGAGCAGCTTACGCACCACCTTCTTGATGTTTTTCTCCATCTCAATTGCAGCCCTGT
CGTAAAGGCAGATAACGTCGTCGGGAAGCCTTGGGACAGATTCGATGGGAAGAAGAAGTCGAAATGGATCGATCTCGCTGTGGTTGGACGCGCCATTAGC
TATTTGCTGGGGTGGAGACAAGGTCGCTGCATTTTCGCGTGGAGGAGGTGCTTGAGCCACTTTAGACGGTGAGGGTATAACGCAATTAACTAGGAAAGGC
GAAGCCGTTCTTACAATCCGCTCGGAAGGAGTAGCTCCGGCTAACTCCACTTCCATCTTTTTCACCACAGCGTGAACTGGGGACGAGGGCTCCGGTTCGT
AATTGACTGCGACGCTTTCTTCCAGCTTTCGATCGCTCTCGGAGTCCAATGTACTGCACGATGAGGCCGACAAATCGGATGTCGTAGAGTGCTGCTTCTC
AATGGGGAATGCGAAACGGTGACGGGTAGGGGGAGGTGGTGGGGGAGACACAGCAGTAGTCTTCTTGGCCTCAAACACGGCGCGCGCCGACTGGAAGGCG
GATACTGCTCTGTTTTCTTCCACCGCAGGCTGGAGTACCGCCTTCGATGTTAATGTCACAACCCCTGGAGGTTGAAGCGGAACTTGAGCTTTTACCGGCG
GCCATCGCTTTACCGGGGAGAGCGCGTCCTTAGGAGCAGGGGGTGTTGCCGCGACATTGCTGGTCCAACGCAGCGCCACGTTAGGCCGGACAGGGGAGCG
AGCGTCGTTGCCAAGGCGCCCTGGGGGCAGAGGCCGAGACGCCATGCTCGCGGAACTGGGGCTCTGTTTGTTGGCTTCTACCGATTGTGCTCCAGAGCAG
AATGGCGCACTGCGAGGCGTAACCGTTTGGCGTAACGGTTTTCGAGGAAATCAGCCAATCGCGTCCATCTCATGTACCACGCAGCTGGTACATTTTTTGT
GTATCGGAGACCTTGATCGCTTGGCATGTCAACACGATAGAAGCTCGATACAGTATCATACATCCGCTTCACTCGCCGTTAAAAGTGAGCACATTGCTGC
CTCGGCCAAAGCGATTGCCTTCAAGGCCAGGTTGAAGGCAAACATCTGATGAGGCCTCAAAGAAAAGGGCGACGCTCGTGGCAAGGGATAATTTGTCGGG
ATTGGGGCCAGCTAACTTTGTAAATTCAGGCGAGCAGTGCTCGCTCAGTGAGCACTGCTCCAGCAACTCTAATCATTCGGATTGATGCAGCCATTTTTGG
GGGCATTGAGTCAATGATTGACGGCCTGTCAAGGCGAAGCGAGGAAAACACAGGCGCGATGAGTTGGTAGCTGTTGTCCACCAGTTCTCGGCAATCCAGA
CAAGGAAAATCTTATGGTGGCGAGGTCTGCACCAACTTGGTGCTACCACACCGCCATGTTGAGCTACACCCAGGAACGTTCCCTTCATGTTGAACTTGCC
GGTGGACCCTTGTTCAAGCTTGTCCTCACCACCAACGTTGAAGCAGCTTTATAACGTTTACGGACCCTGCTGTACACTTCGACGACAACGATCGACTTCA
ATCAACCTCATTCTTGTGGTGAAGTGACGGTGTGGCACCGGACAGACCTTGCCTGTCACTTTTTGAGCTCCTCTCCGCCAGGAGATTTTTTTCATGCGGC
CTGCTTCGTTTATTTCCCATTGGTCAAAATTACAAACACGAAAATCCCATTGGCCCACTGCAAGATACTGATGCTGGTGGTGCACACAAGGCAAGGACAA
GATGCACCGGCCAAGTACGCACGTTTGCTCAAACGGCCGCGGCCTTCAACCAGCCGACGTGGCTCCGACTCCGCTCATTCCGCATTTCGACCCGAGGCGC
ACACAGCCCTAGTGACCTGCACTCCCGATTTCCATAGCCCACAGTAGCAATATGATGCAGACGATCGCCAAGCGCTCGGCCTCCGCGGCCAGGGCCAACG
CGCGCCGCGCCTTCTCGAACGCAGCCGCGACCGAGGCCGGCAAAGAGCGCCTCGTGATCTTCGACACGACCCTGCGTGACGGCGAGCAGTCGCCCGGCGC
CACGCTCAACTTCAAGGAGAAGCTGGACATCGCGCGCAGCCTGAGTGCGCTGGGCGTGGACGTGTGCGAGGCGGGCTTCCCCATCTCGTCCCCCGGTGAC
TTCGACGCCGTGTCCGCCATCGCCAAGGAGATCGGCCCGATCACCGCGAACCGCGCCACGGGCGAGCCCATGACCATCTGCGGTCTCGCACGCGCCATGG
AGAAGGACATCCAGCGCTGCTACGACGCTGTCAAGCACGCGCCTAGCCACCGTATCCACACGTTCTTGGCCACGTCCGACATCCATCTCAAGTACAAACT
GAAGATTTCGCGCGACGAGTGCATCCGTCGCGCTGTGGACGCCGTCAAGTTCGCTAAGAGCCTCACGTCGGACGTGGAGTTCTCTACCGAGGACGCTGGA
CGCAGTGACCCTGACTTCCTGTGTGAAGTGCTCGCTGAAGTCATCAAGGCTGGTGCCACGACGCTCAACATCCCCGACACGGTTGGATACACGGTCCCTG
GAGAGTACGGATCGCTGTTCCGCTATCTGATTGACAACACCGAGGGAAGCGACAAGGCTATCTTCTCCACGCACTGCCACAACGACCTGGGTCTCGCTAC
TGCCAACACTATTTCCGCTGTGCAGGGGGGCGCCCGTCAGGTGGAGGTCACGATCAACGGTATCGGCGAGCGTGCCGGTAACACTGCTCTCGAGGAGCTG
GTGATGGCTCTGAAGACTCGCCCGCAGCACTTCCCGGTCTACACGTCCGTGGACTCAACGCAGATCACCCGTTGCAGCCGTATGGTCAGCCACTACACTG
GTATGTCGATCCAGCCCAACAAGGCTATTGTGGGCTCGAACGCTTTCGCTCACGAGTCTGGAATCCACCAGGATGGTGTGTTGAAGCACCAGGCTACCTA
TGAGATTATGCTGCCGGAGTCTGTGGGTCTGAGCGAAAACAAGATGGTGCTCGGCAAGCACTCTGGTCGTCACGCTTACAGCAAGCGTCTGCAGCAGCTC
GGCTACACCAGCCTCACGCCGGAGGAGCTCGACTACTACGTGGAGAAGTTCAAAGTGCTGGCTGACGAGAAGAAGACGGTCACGGACGCTGACATGGAGG
CGATTGTTTCGGACGAACTGTTCAAGCCTGAAGTCTTCTGGACGCTGCAGTCCGTGCATGTCACCGCCGGTAACCTGGTGAAGCCAACGGCCACGGTCAC
GCTTGCACACAAGGACGGCCAGGAGGTGAGCGAGGCTGCTATGGGCACTGGTCCGATTGATGCCATTTACGTGGCCATCAAGCGCGCTACGGGCATGGAG
AGCATCAAGCTGAACGACTTCTCCGTTGAGAGTGTGACGGATGGCACGTATGCTCTTGGTGAAGTGACTGTGCGGGTGCAGGAAGACAAGGAGGAAGAGG
AGAAGACCGAGGACGAGAAGCATGTGAACGCCCAGACGGGTGTCACTCGTGACCGCCAGTTCGTTGGACACGGTGCTAACACGGATATCCTGGTCGCTTC
GGCTACTGCCTACGTGAACGCTGTGAACCGCATGATGGCATCGCAGGCACGTGGTGTCACTGAGGCTCGGGTGGACGCTTAAGATTACGAAAATACAACA
TCCAAGAAACAAGGACTTCGTCAGCGTTTGCGAATCTGAGCCTGGAATTGTCATCATGGTATGATACCAAGCGAGTGTGTCGCGATCGATCAGGCGAGTG
CTGTGCGTATGTATTATCTAATCGGTGTGAGGAAGGCTACTCTACATCAGCGCAAAATATAGTGTCCAGCGTACGCGAACGATGCGAGCTGGAGCGAATA
TCTCAACCAACTTGTTGCTTTACTCTACAACGTATTTTACTCGGCCGTGAGGCCGTCGTAGGCCGTCAGACCGCTGTTGTTTTCGATGGTATCATCAGCA
CCATGAGCGATCAGATATTCGCCCAGGACGCCTTCACCGTCGTAAGCCATGGCGAAGTGCAAAGGTGTGTTACCCTGCGCATTGCGGTGGTTGATGTTGG
CTCGACGCGTGACCAGGAGCTCCACCATCTTCTGGTTCACGTTCTGGCAGGCGAGCAGCAGCAGCGTGTTGCCCTTGTCGTCCTCGCTGTCGATCGGAAA
TCCAGCATCCAGACTCTCAACCAGCCGCTTCATCCGGCCATTGCGCGCCTGCGAGAACACGGTGCCCACTTCCAACGACATCTCCTCTCCGGCCGGTTCT
TGTCCACGCGCTCGTGCTGCATTGGCCTCATGGTTAACAGCATCTAATTGCGCTCGTTCCGCCGCTGTCAATGGCAGCAACTTGTTGCGAGCCACCATCA
GTTTACGCACGTGGAGTTTGTGCGATACACCCAAGACTTCCGCCATATCCTCGGCACGAAGCTCAATGAGGAACTCGCCATCGACGGCACCTTCACGGAA
CGCCGCCTTGTATTGAGGCAGTGACAAGCCGTCAAGCCATCGACCGACGTCGTCCACCGTCCACGCGCGCAATTCCTCCGGCATTGGCTGCTGCTTCCCT
GGAGCTAAGGCCTCCTGTTCTTCGCGTTGCTGCTGTGCCAGTTCCTGTTGCTTGCGCTGATTCACCGTTGAAAGCAAATTGCTAATGGCATCTCTATCCG
TCTTCTTCGCAAAGGCTGCAGTGACTGGCGTGATATTGGCGGCGGCAGCAGCAGCCGCTGCAGTAGCAGCAGTCTCCGCTGTAGTCGTGATGGCAGCGGC
GGTGGTGTCGGCATTGATATCCCGCAGATTCTTGAGCATGTTGAGAGAGCTGAAGTACGATAACGACATGGACATGAACTGAAACTTCATGAGCTCCTCG
GTGGACTCGAACATGGCCTGTGATCTCGCCTCATGCTCACGTGCTTTAGCTGCAGTAGCTGCCGCTGCCGCTGCCGAAGTCGCTGTGGCTGTCTCGAGCT
CAATGCCCTTTTCACGCAAGTTCTCGAGTTCAAGCTTCTGCTCTTCCAGCAGCTCCATCAGATGCCGTTGCAGACGAGCAAACTCACGATCCTTTCGCAT
TCGAGTCTGCTCCATATCTGCGAGTCGCTCTTCTAGTTCTGCAAGTGCTTCTCGTTTTTGCTGAACCTCGGCGAACACACTCGCAAACTCTGCTTCCAAG
TCGCGCTTCTTCTTCTCGCGCTCGCTGCGCTTGATACTGAGCGCCATCTCGACGGCATACGCGTCTGCTTGGCGCTTCTTGATCGCTTCTTTCGACTCGA
ATACATTTTCAGCGCCTAATTCGTACGGCGCGCCTTCATTGTCCAGAGAGAAGGGAGCATCAGGGATCCCATTGCCGAGACTTTGGTGCTGGAGCGACGA
CCGGTGATTCCGCAGTAAACCCTCAACGCCACCGGCATGCAGACGTTCGGCTTCGTGGGTTAATTCCCGTACGTCGGCATCGAGCTGATCGATTTCTTGT
AGCTCTCGCTCCAGCACTTCCAGCTCTTTCTCAGCTTCACGTAGATCAGTGTGGACGGCACTCACTTGTCGCTCAGCTGCCTCTTGCGCGCGATGCAGTG
CGTCCAATTCGCTCTGCTGTCGTTCGAACGCCTGCTTGGAGCCTTCAATCAACTGGAGCCCAAGTGCCAGGCGTTCAGCTCCTGGTGGTGCGTCACACCA
TTTCTTCTTTCGTGCAGCTTCTCGCCGGCCCAAGAGACCTCGGTACATTCGCTGGATCTCGAGCGCTGCGAGCTCCGAGAACCGAGCAGTGAGGAATTTA
CCACGCGCGACATACATTCGCCACGTTGCTTGCAGTTTAGCTGCGTTTCGATCCTGATAGCGGCGCCGTTCCTGTTCCTTGCGCAGTTTTCGAGCTCGAT
TGCGGCCAAGATGACCACGAAATACCCGCTCCAGCACACGAGCCTTGCTTTCTCGTAGCTTTGCACGGTACGTTATCCGGCAATAAAAGCCTCGGAAGAC
GGTCTCGATGAGAATTGCAGCGTGCAAGCGTCTTGCTGCCTCCTCCTTCTCCTCAAACACTCGGCGGAATCGTCGACGACCTAATCCACCCCGAGCTACC
CGCACGATTTCCCCACCAGCGAACTTTTTGACCCGTTCCTGCTGCATCTCCCGACGTATTCGCTCTACTCGACGCACGGCCAGAAAGCGACGAAGATACT
TCTGCACTCGAGTAGCTTGGGCGTCACGTCTTCGCCTCAACTCACGCTTCATGTTGGACTCGTTGGCTCGAGTATCGTCGCGGAAGTTTTCCTGCAGGGA
AGAACGCACCTCGTCGAACTGTTCTCCGGTCAGATGGCTCTTTGCCATTAGGCCAGGTCCGAGAGCTCGTTGTTTCTGCTCTCGTCGCTTGCGAGCTTGT
TCTTCAGCCTCTAGTTGGTCGAACAAACTCGGGAGTTCCGGTTGTTCTCGAAGCTTTTGCCGCGTTTCCTCCGCAGACGGACCCAACAACGCCTTTGGAG
ACTGAATGGAGGTAATGGGCATTTCTACGGATGGTTCCAGCGTCAAGAATGGCGCAGATTTTGAGAGTACAGCCTCATCCTTCGCTTGCTGCTCTAGATC
TCGTTGTTGGGATGCAACGAGCCGCTCAGCCTGTTGAGCTTGCAATTGAGCGTCGAGATCGGCTAAGCGCTTGAGATCCTCCTCCTCCCATTCACGGCGT
CTTCGCTCTTGTTCTTCTCGCAGAGCTGTCATACGCGCTTCTGTTGCTGTGCGGTGCTTTTGACGCTGCTCTTCGGCTTCCTTCTCGATACGTTCCTCTT
CAGCACGGATTTTAGCTCGGACACTTTCGATGTCGTCCGTGCGAGCATCTTTACGCTCTTTTGGCTGGATTTGGCTCGGTGTTTCATCTTCGTGACTGTA
ATTTGGGACTGGTTGTGGATGCAGAACTGCAGGAGGAAGAGTAGGAGGCAGCAACGTGTCCGTGGGGGCAGCGGATTGAGTTAGTGGGGCGATTTCAGCA
TCCGAAGTCGGTTTAACCTGCTCTTTTTGCTCCCGCAACCACTTTTTCTTTTCACTGTCCGCTTTCTGAGCCCCGTGAGTCCGTATCACCTCCTGAAAAG
CACGCTCAGACTTCTCGAGCTGCAGTTCATAAGGAGTTTTGCTGGATTTCTGAACTGAAGGAGCTGGTGACTCTGACGTTGATTCTTGATGGTCAAATTT
ACTTGGAAGAGGTTGGCTTGACTCCTTTGTCACCGTCAGCACCTGTTTCTCTGCGTATTTTGCTATTGACATTTGCTGTTCATCTGGTTCCTGCGCAGCT
ATTCTCTCCTTCTTCGCCATCTCCATTTGACAATTCACAAGTATCTCCAGCACCTCAGTCACGTATCCTTTGGCTTCCTGACGGAGTTCATGTCCCGCTC
GGATCCACGATACAAAAGCGCTCTTGGGTGTTGCTAGTGCTTTCCTCAACTGCGCACGGGTCTTGGAACGCAGGTCGCTTGTATGTGGCTGCTGGTGAGA
CCACACGTGCTGGATATTGGCTCGACCCTGCAGGAACGGATCGACATTAGTGGGGGCGACGAGCGTGTTCTCCACTGACTGAACGAGAACAATAGGCACT
TGAATTTCTTCCAATTGAGAGCTCAAATCCACGTGGCGAAGCGCTCCACGGCACAAACGAATTCGTCCGTCAAGCGTAATGGCGTTGGTTACTGCAGTGT
AAATACTGAGCGCCAAGTTCATGTCTACTTTATGGAGATACGCTTCGGAAAACAGGAATTTGCTGAAAAAAGACACTGGCAAATCTGGACGTGTCGGTGG
TAGACAAGCGAATACATTCACGGTACTATGAAGAACAGCAGCGAGTTGTGCATCCACACTCGCGAATCCATTGAAAAGCGCGAGAGATTGCAAATATCCG
TCGTAATTTTTGCCATACAAAACACTGTAGCACGTTGCTACATTTGCCCCATT