Description :
From Genome Similarity Track
Location :
Scaffold_19:3133- 5715
Transcript NameFunction/comments
Phyra_76569AlNc14C109G6335

Sequence
2582 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCATGATCATGAGCACGAGTGGCGTCAAGTACGTATTGGTCCTTAAGGACGGAATGAGCGG
GTTCGTCGAGTTGTTGGCATGTACGCACGCGACATCCGACCACGCGTACCAGGGTCTCATCGATTGGTTCAAGCGTTTTGGCGTTGTGCATCAGTGGGTC
TCCGACCAGGGGGCGCATTTTCGGAACCAAGTGGTCGAACGCCTGCAACGCGCCCTGGGTGCGCACCATCATTTCACCACTGCCTACACGCCGTGGGCGA
ATGGCACCGTCGAAGTGGTGAACCGAGAGGTTCTTAAGAGCGTGAAGGCTCTTCTAAGTGAGCGCAGGATGCATGTTCAAGATTGGCCTGCAGTACTACC
GGTGGTGCAAGCGGCGCTTAACGCTATGCCCGCGGACAGGCTGGATGGCCGCTCACCCCTGACAGCGTTCACAGCGTTACCGGCTGACTCCCAGCTTCGC
AGCATTTTGCACCCTCGATCTCCAACGCAGGCAACCCTCGAGTGGGTCGACTCGGAAGTTCGCAGTCATCTCACCGCTGTTCGCGAGGCGTTGGATAATA
TGCATGCGGAAATGGTGAGTGCCAGCGAGAAGCGCCGGCGTGCGGCGCGGGAGCGGCATGCGCGTCGCCAAGGTGTGCGGCTTCACAAGTTTAGCGAAGG
TGATTTCGTCCTGGCGGCGACAGCAACTGGGCGCAGTGGGCACAAACTGGCCTTGGTGTGGCGCGGCCCTAAGCGCATCCTCAAGGCGCTGAATGACTAC
ACTTTCGAGGTCCAAGATATTATCGAGCCATTCGCTGTCACTATCCGCCATGCCTCCCGACTTCAGCTTTATCGCGACGCCGCCCGTGGGCGCGTGGAGG
AGCTCCAAGAGCAGGCAATCTACGGCGAGGGTGGACATCTGGTTGAAGCGCTGCTCGACTGTCGGCTGAGCCCGGACTCGCACCGTTGGGAGGTATTCGT
CAAGTGGTTCGGTCTTGACGACATCGAGGCGTCATGGGAACCAGCCGACATCATCAAGCAGGATGTGCCGGGCCTTTTTCAGGTTTTCGTCGACGACCAG
CCTGAAGCTCGGTCCCGCCGCGACATGGCGGCCGCGTTGGCGGGTCCCGACCGCGATGACGAACGTCCAGCCCAGCGTGCCCCCCGCCGACGCCAACCGC
GCCAGCCGCGACCCTGATTACCGACTTCACGTGGAGGGGGAAGTGATCCGCCGGCTGCTCCAGCGGAACCCTCCTTCTGGCTCTCGGAGGCTACAGGTCT
TTACACGACTGATCAGGCAAGACACGACGACTCGACCAGGTTGGCGACCGCGCCGAGGTACGTAAAGGAGAAGAGGTCTAGGTAGGGCAGCGAGCAGAGA
GAGAGAGCCGAGCTAGCAAGAGGCTAACCGGAATCGAACTCAGTTTTTGAATTTGCTCGGTAGAGAGCTTTCCGTTGGAAACGGATCACTCCTGACGATG
GTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTA
TGGCCCCCCGAACATGATAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCAAGCGACACCCGCAGCGGACTACAGCAACGTACGTGTAGATGCATATA
TATATATATATATATATAATAAACCACTTTTCGGTTTCGGGAGTTCCGCCTGTTGGGATAACTGGTACCTCCAGGGCAGTTCGAGGATATATTCGCATAG
AATTAGGGGTAGCCTGGTGCCTATTTAGGGGTCTTAGGACCCTTATTTGGGAGGCCCTGGGTTGTTGTAGCGGGAGCCGCGCCACGACCACATTGTCGAG
ACAACCCAGCGGTCGCGTAGACGCCGGACAGTCGCTCTGAAGCCACAACAATATTATTGTATTATTTGTATCCGATTTAATTATTGGGTATGAAAGTACT
ATAGTACTGTGGATTTTATGCACTATATCCGTTACTTTCCTTTGTAAAGGTGTTTTTAACACTTTACTAGGATAAGAAAGGC