Description :
From Genome Similarity Track
Location :
contig_97:31327- 33093
Transcript NameFunction/comments
g12832.t1hypothetical protein

Sequence
1766 bases(100 bases per row)
ATAAATGATAACGCCATACTCATCAGGTCGACATGTATCCACTTCAATCCGGAGGTGGATGTCTTCTGAACACAACCGGACATAACTGGACACCACTGTA
CACAACTGGCCATAACTGGACACACCCGCAATCTTTCCATCGCGATTCCTCCAAACGCGATCTCATGCCATCAGTCCCTTCCGAATCGCTCAATCTCTCC
AACTGACAAGTCGCTTCACCTCAAGTGCAACTAGATCCTTTCGAAGCTCGACGCCAATGCACGTTCTAACGCTCGTCGCAAGTGCAACTTGAGCGACAAT
GTTGCCCACACCAGCTCCAACATCGAGGAAAACGTCGGCTTCTCCGAGGGGTCCAACAGCTTCAAGTATCTTTGAGACACCCGACGGTAACACCTCACCA
GCATTGCCATAAGTACGGCCGGCTTGCTGGCGGACATCGTGCGCACTGATTCCTGCAAATATGAGATTCACAGCTTTCGCTGCTTGCCCTGGGTTGAGTA
TAGTTTCACGTGACTCAGCGGCGACGCAGCCCGCGAAGGTGGTACTGCCCACAGACTTGAATATGGTGTGGCTCACCGGCTCGGACGTGGTGTTGACCGC
AGACGTGGCTACGGCGGCGATCCCGACACGGTCACCAGCCTCGGCGGAGAGGCTGGGCATGGTAACGGAGCCGCGCACGGACTTGGTGGCAGCGCGGTCT
GAAGCCTTGGCCTTGACGTCCATGGCGGCACGGACACCAGACTCCGCTGCGAGGCAGCTGGTGACGGCGGTGTCACGGACAGACTTAGTGCGCATGACCT
CGGTGTCGGTGCTGCTCGCGGGCTGGTTGGGGCTGTTGCTCGCGGACTTGAAGGAGGACCCGGTGTCGGTGCCAATGGCAACACCACCGCCTGATCCGTT
GGAAAGACTAGCCGAGGTTGTGGTGGAGGGCGTGAGGCCGAGACGGGGAGGTGGTGCGTGCGTCGGCGCTATTAGTCGCCGGGAAATGGGGAGAGATGGC
GGCGGCCGAGCTCGCGCGACTAGAACTCCCCTGGAAGGCAGACCACTGAAAAAGCACCGCGGAAAGCTGCTTATGGTCTTCCCGTACGTCCTCTTGAGAC
TGGCCAGCCGAAGACGGAGCTCGTTCGCAGAGCGCTTGGTTTTCATCCGACGGGCCACATATGCCCAGGTGATGCGAAGGCCTTCCCTCTCGAACTGAAG
TGTGATCTGGACCAGTAGCTTGTCTTCTTTGTCAGTGAAACTTGTGCGCATTTCTGCTAATTTTTGTATGTGAAATGAAGTCAGCATGTAGTGCATTTGA
CTTACCTTATGTATGGCGATATGACTGGCTGCACGGTGATACTGGTGCTCATTGTTTTTGCAGCGCTTGGTCGATGACGCGGCGGTGCGGCTGCGACCGA
TTACGGCGGCTGAAGCAATAAAATACACCTCGGAGACGCGAGCATTTGAAAAATACCCCCATCCCTCTTAAACAAAATGCTGTGATTGGTAGTAATATTA
CACGGTAGGTCGAGCGCGGGATTAGGCTAAAAGGGCGCAACAATCGCCCTTTTAGAAGTCCATTTGTCACCGTGTTTTGGAAACAGCGTTAAAGGGCGAG
AAATGCGCCCTTGCACCGCGAAAGGGTTAATTAATTAGCTAAGTTCGCTTTCGTTAATTTGCTTAAGTTCCGACTTGCTTGAATATTTTTTTCTTACGAG
CACGAATTTCCGTTCGATGCTTCTCATCATATTCTCGCTGCTTCGCCAGTCGCGTTTCCCTTGTCT