Description :
From Genome Similarity Track
Location :
Scaffold_24:31325- 32383
Transcript NameFunction/comments
Phyra_77339conserved unknown protein

Sequence
1058 bases(100 bases per row)
GATGGCGTACAGGATGACACCGCAGCCGATCATCAACACCGGCGTGTCCATCGTATGCGGCGCAGTCGCCTCCGCGTACGCCATCGTCGGCGCCAGGATC
AGCATCGACAGCAGCACCTGCCAGAAGTTGTCGAACGCGGCGTACTGCAGCGCAGGGAACACCAGCCCAGACACGAACACGCACGCGCTTCCCTCCCAGC
TGCGCGTGTACTTGTTCTTGCTGAAGCAACTGCGCGTCTTGTACTTGTGCTTGCCCCACGTGATGCCCACGGGCTCCGCCAGACCGTCGCCGATTCCCGT
GATGAACACGAGGATGAACGTCAGCGCGCCCTGAGCGGCGAACAGCCACTTGAAGAACATGAGGATGAACATGCCCGGAGCGATGTTGCCCACGATGATC
CACTTGAGCGTGTTCGGGCGATCCTCCGGACGATCCAGCGAGTTGAACTGCAGCATGAAGAACTTGGAGTGCTCACGGATGGGCTTGATGAGCACGAGGA
AGCCCAGCATGGTGAAGAGGTCGCCCCAGGCCAGGGCGATCGGGCCGGAGTAGTCGGACTTGATGACCAGCGGCACCATGTAGGCGGCGAAGTGCTGCAG
CTTCCGAGTGTAGTTGACTTTGAACTTGGACGACTTGTTGGTCATGATGTAGCCCTTCTCGTCGACGTCGCAGAAGCAGCGGCAGATGATACCTCCGAAG
AGGGACACGACCATCATGACCACGAGCTTGGGCAGCTGCATGAGCCAGAAGTGCGGGTCGAGAAGCCACTGCGGCTCGTAGAAGAAGGTGAGAACCAGCA
TCACGGCAGCGTAGACGACCATGCCGACCAGGAAGGCGAAGTCGAACGTGTTGTACCAGTGCTCCTCGTAGTCACCGGCCACCTCGCCCTCCTCGACGAG
CGAGGTCTTGACGGCAGTGATGGGCTGCAGCTGCTCGCCCGTGGCGCCGTACGAGGGCACGGGAGCGCGCACAGGCAACGGCGTAGGCACGCGCCACACG
AGGCGCAGCATGACGTAGCACAGCAGCAGCGCCGCGATGGGCAGCGCAACGAGCACGA