Description :
From Genome Similarity Track
Location :
scaffold_993:3132- 4937
Transcript NameFunction/comments
g10789.t1 hypothetical protein PHYSODRAFT_310534

Sequence
1805 bases(100 bases per row)
TCCTCCAGTGAGCTCGCGCGATTAGCGAGAGTCGCCGATGAGAGAGATTTTCCCAATCACCACTTCAATTTGCTCGAAGGTCCATATATCCATTCAGATC
GGTACAAATCTTTGGGGCTTGTTATTGCGGGAAGAACGCTGATCGCCAGAAAGTCCTTCATGGTCCACTCGAGGCTTGGAGGCGAGCTTGACACCTGATC
TCCACATTATTGTTGTGGGCCAATGTGAGAGAAGTCGGAAATGACGTGGCAATTTTCACCAGCGCAGCATTTATCAGTGTCGTCAAGTGAGCGGCGCAGA
TAAGGACGCGTGAGACGGGCAACTGTGCTGTATCCCTGCACACGCTTGCGCAAGCTCGCTGATAGACGAAGAGTCTTCGTCGAAGACGTCCCCCTGGGCT
GTAGTGAACGCCCAATTCGACGATTGCTTCTCTTGTAGCTACAAGAAAAGAAACCCCCTCCCAACACCAATTTTAGACATGACGTCAAGTTTCAACCGTC
AGAGCTGCATACTTATCGACTTTACCTCAGCTGCTTGTTTAAAAGAACACTAAGCTCAAGCCGCATTGGGCTCCGGCGTCTTACTCTCCGTGCTGGTATT
CATCCCGAACTGCATCCGTTTCATCACCACTACGAAAAACAATATGTTGACGATCATGAGCGCGCCGAGAGTAAAGAACAAATACTCGAGGTGCCCGTTG
TTCAGGTTCGCCGGAATGAACTTGCCAAAGAGCAGTACAATAATCGACAACAAGGAGCTGCCCATCGAGTTCACGAAAAACGCGAGCGCGATTGACGTAC
TGCGCATGCTCTGAGGAACCTCCGAGTAGTTCAAGTCATAGGACGGGATGCAAATCAACACACCAGCCAGAGAAACTAGCAGATAGTGTGGGATCGTGGT
CCACCAAGGGATATCGTTCATGACTTCACCTCCATCGTCATCCAGCAGGAACTGTGTGATACCGTCCACATCGATGTACGTCAGTGGTGTAGCGCTGCGT
CGAATGACCTCGTAACAACCAGTCCAGACCATGGCCACGACCGCTACGCAGTATCCGGCGAGGATTTTCCCGTACGGACTGGGAGCTTTTCCGGCGTACT
TGGCGTACAACGGGTATATTACCTTCTCCAGAAAGGGGATAAAAAACAATGCAGCAACTGGGTTGAACAACTGCACCATAGGCCCCGGAATTTGGCTTGC
AAACGTTCCGCTTCCAAGACGTGTGTCGGTTTGTTGAACAATTGACTGATTGTTTCCGCGCTGGTTTTGGCAGACCCACCAGAACACATTGAAAGCGTTG
AGTGGGAGGATACGAATGACTTGTTTCACGTCCTCTACCATCTTGGAATCGAAGTTTCCTCCCAGTGTCTGCTTCGCACTCTCCATGAACGAGGAATCAC
GACCGACGGACACCCAAAGGATAGTTGCGACCACTATCATCACTCCCGAAGCGTAGGAGATGTCGTGTCCGACGTTCCCTTGGTCCGATAGAACGGACGC
GAGGATATTGCACAAGAATGCGGTGATGTACAGCAATGTCCCCAGCACGATTAGTTTTGCTTGAAAGTTCTTCTTCGCATGTCCAGATACAACGCAAATC
ACTACGGCAATGGATTGTTTCGTCGGAGGAACATTCACGTATCGCGAGCGAGTCGTCCACAGCACGATTGAAAAAGCAAGCACCACCGCGAAACCGACAA
TGTACACAAAGAAGTACCCGTAGTCTGCAGGGATAGCTCCGATGCCGTGGATGGACACCCACGGGAAAACGAGGTAGCCGATGAAAGCGCCTAAGTTGGC
ACCCC